Bisphenol A diglycidyl ether-induced DNA methylation abnormalities may disrupt testis development in adult male zebrafish

Article information

Environ Anal Health Toxicol. 2025;40.e2025s05
Publication date (electronic) : 2025 May 7
doi : https://doi.org/10.5620/eaht.2025s05
1Institute for Catholic Integrative Medicine, Incheon St. Mary’s Hospital, The Catholic University of Korea, Incheon, Republic of Korea
2Department of Biology, University of Ottawa, Ontario, Canada
3Department of Environmental Engineering, Seoul National University of Science and Technology, Seoul, Republic of Korea
4Department of Convergence Science, College of Medicine, Catholic Kwandong University International St. Mary’s Hospital, Incheon, Republic of Korea
*Correspondence: yangyj@ish.ac.kr
ǂThese authors contributed equally to this work.
Recommended by: Prof. Yong Joo Park
Received 2025 January 17; Accepted 2025 April 8.

Abstract

Bisphenol A diglycidyl ether (BADGE) is commonly used to stabilize products synthesized from epichlorohydrin and bisphenol A. Although recent studies suggest that BADGE may adversely affect the male reproductive system, its underlying mechanisms remain unclear. This study investigates the impact of BADGE exposure on steroidogenesis via DNA methylation changes in adult zebrafish gonads. Adult male zebrafish were exposed to BADGE (10 μM) for 21 days (n = 15 per group). Genomic DNA and mRNA were extracted from the testes. Whole-genome bisulfite sequencing revealed differentially methylated (DM) regions, and the expression levels of genes associated with these DM sites and steroidogenesis were analyzed using quantitative reverse transcription polymerase chain reaction. Among the 2,673 DM sites (1,311 hypomethylated and 1,362 hypermethylated), 1,533 were successfully annotated. Pathway enrichment analysis showed that DM sites were associated with the phosphatidylinositol signaling system, inositol phosphate metabolism, cardiac muscle contraction, insulin resistance, insulin signaling, and the forkhead box O signaling pathway. Notably, the gene expression of insulin receptor substrate 1 (irs1) was significantly upregulated in the BADGE-treated group. In addition, the mRNA expression of steroidogenic enzymes, including steroidogenic acute regulatory protein, cytochrome P450 family 17 subfamily A member 1, and cytochrome P450 family 11 subfamily A member 1, was significantly increased in BADGE-treated group compared to the control group. These findings suggest that while BADGE may directly influence steroidogenesis, DNA methylation of insulin signaling-related molecules, including irs1, may also contribute to this process.

Introduction

Bisphenol A diglycidyl ether (BADGE) is synthesized through the reaction of one mole of bisphenol A (BPA) and two moles of epichlorohydrin [1]. It has 100 times lower estrogenic potency compared to BPA, which is a well-known endocrine disruptor [2]. It is widely used in epoxy resin production, especially for protective coatings and civil engineering applications [1]. Food and drink cans coated with BADGE-based epoxy resins can leach BADGE into consumables, resulting in human exposure. Based on consumer exposure data, the calculated annual intake of BADGE from canned food is 6 -10 μg/person/day [3]. Given the estimated daily intake for a 60-kg adult of 0.098-0.16 mg/kg of body weight, the higher value is used as the estimated daily intake level.

BADGE, when intact in vitro [4-6] and in vivo systems [7,8], is rapidly hydrolyzed to form the corresponding bis-diol, which is not observed in BPA. When 14C-BADGE was orally administered to mice, it was metabolized and excreted mostly (being over 88%) within two days [7]. In a phase I in vitro liver metabolism study, BADGE was rapidly hydrolyzed and resulting in the formation of hydrolysis derivatives [9], and further hydroxylation and carboxylation, which have been detected in urine [10-12], in serum [13-15], and in adipose tissue [15]. Because BADGE is unlikely to be transformed into BPA, it has not been widely considered a potential inducer of systemic toxicity.

However, BADGE (10 μM) induced minimal proliferation (<2 fold) in the E-Screen assay [16, 17], and BADGE (200 μM) induced morphological changes in Caco-2 cells and cellular detachment from the substrate [18]. In addition, the hydrolysis and chlorohydroxy products of BADGE exhibited proliferation in the T47D breast cancer cell line from 10-14 to 10-4 M, without binding to estrogen receptor alpha (ERα) [19]. Additionally, up-regulation of luteinizing hormone and disruption of steroidogenic enzyme expression were observed in a mouse testicular cell line after exposure to the hydrolysis derivative of BADGE [20]. Orally administered BADGE at 750 mg/kg/day may reduce sperm count and motility while increasing sperm abnormalities in adult male rats [21]. A decrease of spermatid numbers in the seminiferous tubules and relatively lower testosterone levels [22], and an increase of anogenital distance (AGD) and a down-regulation of clusterin mRNA expression in epididymis [23] in adult male offspring were also observed in perinatal exposure to BADGE at 375 mg/kg/day. A significant dose-dependent decrease in clusterin mRNA and protein levels was observed in male offspring perinatally exposed to BADGE at 50, 200, and 400 mg/kg/day [24]. In accordance with laboratory studies, serum BADGE and its hydrolysis derivative levels in adult male workers were positively associated with follicle stimulating hormones and negatively associated with estradiol [14]. These findings suggest that BADGE may disrupt steroidogenesis, potentially affecting gonadal development, although direct evidence is limited.

Epigenetic changes induced by environmental factors have been considered a sensitive marker of environmental effects [25]. DNA methylation is an essential epigenetic modification in which a methyl group (-CH3) is enzymatically attached to cytosine residues, primarily within CpG dinucleotides, playing a key role in gene expression regulation [26]. Studies have shown that the alterations in DNA methylation are associated with abnormal male reproduction and infertility [27, 28]. Although it has been suggested that BADGE may cause male reproductive damage [20-22] and be associated with steroid hormones in adult men [14], information regarding its potential impact on testicular development remains limited. Examination of epigenetics changes in the gonad may provide insights into the disruption of steroidogenesis caused by BADGE exposure.

In addition, Danio rerio, commonly known as zebrafish, is a suitable model for assessing epigenetic alterations induced by environmental chemical exposure, given that its genome exhibits approximately 70% homology to human genome [29]. The use of zebrafish offers several advantages over other model organisms, including ease of husbandry and maintenance, high reproductive output, external fertilization, and a short life cycle with rapid generation times [30]. It is suggested that examination of DNA methylation in zebrafish may help uncover the underlying mechanism in male-mediated reproductive defects resulting from BADGE exposure.

Therefore, this study evaluated the epigenetic effects induced by BADGE using whole genome bisulfide sequencing (WGBS) on male zebrafish gonads. To our knowledge, this is the first study to use WGBS to examine the disruption of steroidogenesis in zebrafish exposed to BADGE. Understanding these epigenetic effects could provide valuable insights into BADGE's role as an endocrine disruptor.

Materials and Methods

Chemicals

BADGE (CAS No. 1675-54-3) and dimethyl sulfoxide (DMSO, CAS No. 67-68-5) were purchased from Sigma-Aldrich (St. Louis, MO, USA). DMSO (0.001% v/v) was used as the solvent.

Fish Husbandry and BADGE Exposure

Adult male zebrafish (3–4 months old) were obtained from a commercial vendor (Gwansune System, Osan, Korea). Fish were maintained at 26 ± 1 °C under a 14:10 h light-dark cycle and fed Aquatox Fish Diet flakes (Zeigler, PA, USA) twice per day, supplemented with brine shrimp. After acclimation, fish were divided into three replicates (five fish per 2L beaker). BADGE was dissolved in DMSO to prepare a stock working solution. The final concentrations of DMSO and BADGE (10 μM, 3.4 mg/L) did not exceed 0.1%, ensuring no effect on any endpoint measured. The exposure concentration of BADGE was determined based on a tolerance daily intake of 0.15 mg/kg bw/day, which was established by European Food Safety Authority [31], and a dose did not induce cytotoxic effects in Caco-2 cells for 24 h [18]. Half of the exposure media were renewed daily, and water quality (dissolved oxygen, pH, conductivity, and temperature) was routinely monitored. No mortality occurred during the exposure. After 21 days of exposure, males (n=15/group) were anesthetized and dissected on ice in each group. The experimental duration was determined based on the OECD test guideline 230 [32]. Testes were immediately separated and rinsed in saline (0.9% NaCl), and immediately frozen in liquid nitrogen. The collected tissues were kept individually in the tubes and kept in -80 °C until being further processed. The experiments were carried out by Central Bio Inc., and all procedures were approved by the Institutional Animal Care and Use Committee (IACUC), in compliance with institutional guidelines and regulations.

Whole-Genome Bisulfite Sequencing

Genomic DNA was extracted from frozen gonads (n=10/group) using a Qiagen DNA isolation kit (Cat. No. 69504) according to the manufacturer’s protocol. DNA yield was measured using a Nanodrop spectrophotometer (Thermo Electron Corporation, USA) and stored at -80°C until being further processed. Samples were pooled to minimize biological variation and due to the limited amount of DNA available.

Bisulfite conversion using the pooled DNA samples was performed to convert unmethylated cytosines to uracils. The Adapter step is a highly efficient, template-independent reaction that performs simultaneous tailing and ligation of a truncated adapter to the 3' ends. In the Extension step, truncated adapter 1 is incorporated through a primer extension reaction. The Ligation step selectively adds truncated adapter 2 to the bottom strand only. During the Indexing PCR step, full-length adapters are incorporated for single or dual indexing, while also increasing yield. Bead-based clean-ups remove oligonucleotides and small fragments, and adjust the enzymatic buffer composition. Sequencing was conducted on a HiSeq X platform (Macrogen, Korea).

Identification of Differentially Methylated Sites

After sequencing, methylation changes exceeding 5% (p-value < 0.05; within 1,000 bp) were annotated to the nearest gene. This threshold aligns with prior studies [32-34].

Gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analysis

The functions “enrich GO” and “enrich KEGG” were applied with default parameters to identify significantly enriched GO terms and KEGG pathways, with a threshold of p < 0.05. For GO enrichment, differentially expressed genes between control group and BADGE treated group, as well as down-regulated genes with hypermethylated regions (hyper-down) and up-regulated genes with hypomethylated regions (hypo-up), were used as input data.

Quantitative Real-Time PCR Analysis

Total RNA was extracted from gonads (n=5/group) using a Qiagen RNA isolation kit (Cat. No. 74004) and reverse-transcribed to cDNA using PrimeScript™ RT Master Mix (Takara, Japan; RR036A). The mRNA expression of identified genes and steroidogenic enzymes was analyzed via qRT-PCR. Relative expression levels were determined using the ΔΔCt method, normalized to the average of glyceraldehyde-3-phosphate dehydrogenase (gapdh), β-actin, and ribosomal protein lateral stalk subunit 0 (rplp0). Primer sequences are listed in Table 1.

Primer sequences used for qRT-PCR amplification.

Statistical Analysis

The quantitative results are expressed as mean ± standard error. Group comparisons were conducted using the Wilcoxon rank-sum test. Statistical significance was set at p < 0.05. Data analysis was performed using STATA/MP (version 18.0 StataCorp LP College Station, TX, USA).

Results and Discussion

Following a 21-day exposure to BADGE, WGBS analysis was performed to assess DNA methylation in the gonads of zebrafish,. Approximately 55 Gb (ranging from 54 to 57 Gb) of raw data were generated from both the control and BADGE-treated groups. Bisulfite conversion was 99.7% for all samples. About 97% of bases had quality scores greater than Q20, and 93% scored greater than Q30. The mean mapping rate was about 52%. Methylation in the CpG context was 79.6% in the control group and 78.7% in the BADGE-treated group. Cytosines in CHG and CHH contexts were approximately 0.5% methylated, respectively. Of these CpG methylated sites, 2,673 sites were differentially methylated (DM) between the control and BADGE-treated groups, with 1,311 DM hypomethylated sites and 1,362 DM hypermethylated sites. Total DM and hyper/hypomethylation varied among chromosomes (Figure 1). Chromosome 24 had the fewest hyper/hypomethylated sites (29 regions and 26 regions, respectively), while chromosome 4 had the greatest number of hyper/hypomethylated sites (94 regions and 110 regions, respectively).

Figure 1.

Hypometylation and hypermethylation per chromosome in zebrafish gonad exposed to BADGE 10uM during 21 days. Cutoff for differentially methylated sites is q-value <0.01, p<0.05, and within <1000 bp.

Of the 2,673 DM sites, 1,533 were annotated to zebrafish genes. The functions and pathway enrichment of the DM sites were evaluated using the DAVID website (https://david.ncifcrf.gov/list.jsp). GO analysis further classified the DM sites into cellular components, molecular functions, and biological processes. Six KEGG pathways were enriched (p < 0.05 and q < 0.01) for genes containing DM sites: the phosphatidylinositol signaling system (17 genes), inositol phosphate metabolism (14 genes), cardiac muscle contraction (13 genes), insulin resistance (16 genes), insulin signaling pathway (19 genes), and FoxO signaling pathway (18 genes) (Table 2 and Table S1). Among them, phosphatidylinositol signaling system, insulin resistance, insulin signaling pathway, and forkhead box O (FoxO) signaling pathway are related with phosphatidylinositol 3-kinases (PI3K)/protein kinase B (AKT) pathway, which is the most crucial signaling pathways in cellular metabolism [35]. In the testis, the PI3K/AKT pathway plays a role in spermatogenesis and Sertoli cell development [36-38]. Studies on the mechanism of BADGE-induced PI3K/AKT dysregulation with testicular toxicity are still limited. However, exposure to BPA (20 mg/kg every 2 days for 2 months), a precursor of BADGE, induced germ cell loss, and decreased sperm viability, motility, and density [39]. They suggested that BPA-induced testicular toxicity might result from the dysregulation of a DPY30-mediated H3K4me3 epigenetic modification, which regulates the PI3K/AKT pathway. In addition, although unrelated to reproduction, exposure to BADGE and BPA interfered with the PI3K/AKT pathway and resulted in the reduction of vincristine cytotoxicity in lymphoblstic leukemia cells [40]. Based on these previous studies, BADGE-induced testicular disorders might be associated with the alterations in the PI3K/AKT pathway.

Enriched KEGG pathways for genes containing differentially methylated cytosines in the testis of BADGE exposed adult male zebrafish.

Based on KEGG pathway enrichment analysis, the most frequently identified genes, including phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma (pik3cg) and phosphatidylinositol-4,5- bisphosphate 3-kinase catalytic subunit beta (pik3cb), were selected. Additionally, phosphoinositide-3-kinase regulatory subunit 3b (gamma) (pik3r3b), insulin receptor substrate 1 (irs1), and insulin receptor A (irsra) were selected due to their common presence in the insulin signaling pathway and insulin resistance. Among the selected genes, differentially methylated sites with a methylation change exceeding 5% and a p-value less than 0.05 were annotated within 1,000 bp. In the BADGE-treated group, irs1 and pik3cg exhibited hypomethylation, while irsra, pik3r3b, and pik3cb showed hypermethylation compared to the control group (Figure 2).

Figure 2.

The difference of methylation of identified genes in zebrafish gonad exposed to BADGE 10uM during 21 days.

The mRNA expression of the selected genes was examined to evaluate the relationship between DNA methylation and gene expression following BADGE exposure in the zebrafish gonad (Figure 3). The irs1 mRNA expression was significantly increased in BADGE treated group compared to the control (p=0.023), which may be associated with the hypomethylation of its respective CpG sites. Irs1 is the first identified member of the insulin receptor substrates family and is found in various tissues, including muscle, adipose tissue and liver, which are insulin-responsive tissues [41]. In ovarian granulosa cells, phosphorylation of IRS1 plays a role the transmitting follicle-stimulating hormone (FSH) to active PI3K [42]. Specifically, in the presence of both FSH and insulin-like growth factor 1 (IGF1), protein kinase A activates protein phosphatase 1 (PP1), which dephosphorylates Ser/Thr residues on IRS1, thereby facilitating IRS1 phosphorylation by IGF1 receptor. The phosphorylated IRS1 then enhances the PI3K/AKT pathway, driving a synergistic gene response to IGF1 and FSH [43]. Although statistical significance was not observed, the up-regulation of pik3cg, which is involved in the PI3K pathway, might be induced by the increase in irs1, resulting in the activation of the PI3K/AKT pathway. Nevertheless, adult male rats with orally administered BPA (0.005 – 500 μg/kg bw/day) showed a dose-dependent decrease of insulin signaling molecules including insulin receptor, IRS-1 and PI-3 kinase in testis [44]. The inconsistent results with our study might be attributed to the differences in the chemical used and exposure dosage. Nevertheless, it seems that BADGE could disrupt insulin signaling transduction and thereby induce male reproductive disorders, and in that process, IRS1 might be a key mediator of steroidogenesis in the testis.

Figure 3.

The mRNA expressions of commonly identified differentially methylation regions in zebrafish gonad exposed to BADGE 10uM during 21 days.

In addition, in contrast to the irs1 and pik3cg, the mRNA expression of hyper-methylated genes such as insra, pik3r3b, and pik3cb was increased in BADGE treated group compared to the control group (Figure 3). In general, DNA methylation influences gene expression by recruiting proteins that promote gene repression or by preventing transcription factors from binding to DNA [28]. However, in some cases, genes that undergo hypermethylation may retain their expression levels or even become upregulated [45, 46]. One possible explanation is that certain transcription factors preferentially bind to methylated CpG sites, leading to gene activation rather than suppression. Genes with unmethylated CpGs in the promoter region may not produce functional transcripts [47-50]. Additionally, local methylation patterns can play a more significant role than overall methylation status. Even if a genomic region is hypermethylated, localized demethylation at critical regulatory sites can allow gene transcription to continue [51, 52]. Furthermore, the density and distribution of methylation influence gene expression. A low level of methylation in promoter regions may still permit transcription machinery to bind, and sparsely methylated genes can be activated by enhancers despite the presence of global methylation [51, 53, 54]. It has also been shown that certain genes with unmethylated CpG islands in the promoter regions are unable to produce functional transcripts because RNA polymerase II is not recruited [55]. Thus, the simultaneous increase in both gene expression and CpG methylation levels is uncommon but can occur. Since these complexities suggested that a toxicant like BADGE might influence gene regulation in unexpected ways, it is needed to evaluate the specific conditions under which hypermethylated genes induced by BADGE exposure may still exhibit increased mRNA expression.

To estimate the influence of BADGE on steroidogenesis, the mRNA expression of steroidogenic enzymes including steroidogenic acute regulatory (star), and cytochrome P450 family 11 subfamily A member 1 (cyp11a1), cytochrome P450 family 17 subfamily A member 1 (cyp17a1), hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 (hsd3b2), and hydroxysteroid 17-beta dehydrogenase 1 (hsd17b1), as well as estrogen receptor 1 (esr1), were measured. The mRNA expression of star, cyp11a1, and cyp17a1 was significantly increased in BADGE-treated group compared to the control (p=0.032, p=0.018, and p=0.020, respectively [Figure 4]). Despite statistical significance not being observed, BADGE also increased the mRNA expression of hsd3b2 and hsd17b1 compared to the control group. These results are consistent with the previous study that the hydrolyzed form of BADGE (1 μM) increased steroidogenesis enzymes such as Star and 3β-HSD in mouse testicular Leydig cells [20]. In addition, BPA (1 μM) increased the expression of CYP11A1 and CYP19 in mouse Leydig cells [56]. They suggested that the decrease of sex-hormone ratio (testosterone/estradiol) following BPA exposure compared to the control might be associated with the up-regulation of CYP enzymes in vitro and in vivo. However, A decrease in luteinizing hormone receptor and HSD17B3 expression was observed in Leydig cells isolated from adult male rats after maternal exposure to BPA (2.5 and 25 μg/kg/day) [57]. Although environmental disrupting chemicals can directly affect sex hormone balance through modulating the expression of steroidogenic enzymes, there is evidence that the activation of insulin receptor might influence steroid hormone synthesis through enhancing StAR protein expression in human ovarian cells [58].

Figure 4.

The mRNA expressions of steroidogenic enzymes including steroidogenic acute regulatory (star), cytochrome P450 family 11 subfamily A member 1 (cyp11a1), cytochrome P450 family 17 subfamily A member 1 (cyp17a1), hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 (hsd3b2), and hydroxysteroid 17-beta dehydrogenase 1 (hsd17b1), as well as estrogen receptor 1 (esr1), were in zebrafish gonad exposed to BADGE 10uM during 21 days.

StAR has an important role in the transportation of cholesterol from outer to inner mitochondrial membrane, and regulates the production of steroid hormone biosynthesis [58, 59]. In addition, CYP enzymes are located on the endoplasmic reticulum network, and play a role in catalyzes the final stage of steroid biosynthesis [60]. Among the CYP genes, CYP11A1 and CYP17A1 genes play a key role in steroid synthesis and production, cholesterol, and drug metabolism. CYP11A1 gene is mainly involved in androgen metabolism and cholesterol side-chain cleavage, and CYP17A1 gene is involved in the biosynthesis of androgens as a 17-20 lyase in the gonads. In addition, HSD3B2 has a role in the conversion from pregnenolone to progesterone and from dehydroepiandrosterone to androstenedione through dehydrogenase and isomerase reactions [61]. HSD17B1 plays a crucial role in estrogen and testosterone synthesis [62]. Although there is evidence that several upstream regions participate in the regulation of reproductive development, it seems that BADGE directly affects the activity of steroidogenic enzymes.

It is thought that BADGE has estrogenic properties that can induce biological actions. In this regard, the level of ESR1 in the male testis was examined. The expression of esr1 in the zebrafish gonad tended to increase following BADGE exposure compared to the control; however, statistical significance was not observed (p=0.132; Figure 4). Although previous in vitro study suggested that estrogenic activity following exposure to BADGE hydrolysis and chlorohydroxy derivatives (10-14 to 10-4 M) was not associated with ERα in the T47D breast cancer cell line [19]. However, Maternal exposure to BPA (2.5 and 25 μg/kg/day) significantly increased ESR1 protein levels in Leydig cells isolated from adult male rats [57]. Because the elevation of ESRs following BPA exposure might interfere with the tissue differentiation in prepubertal Leydig cells [63], BADGE might modulate the ESRs and thereby induce reproductive defects.

Conclusions

Studies have reported that BADGE had no effect on reproductive or endocrine toxicity [64, 65]; however, it has also been shown to exhibit estrogenic effects in vitro [16, 17, 19, 20] and in vivo studies [21-24]. Based on our results, BADGE may directly disrupt steroidogenesis, while DNA methylation of genes related to the insulin signaling molecules, including irs1, could also involve in the reproductive development of adult zebrafish gonads. However, due to the limitations of small sample size, it is hard to establish a definitive relationship between BADGE exposure and epigenetic changes in steroidogenesis. Further studies are needed to elucidate whether BADGE-induced DNA methylation in zebrafish gonads influences the steroidogenesis by interfering with the PI3K/AKT pathway.

Notes

Acknowledgement

The authors thank Central Bio Inc. for their technical support in zebrafish husbandry, chemical exposure, and necropsy procedures. This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) (NRF-2021R1I1A3046386 and NRF-2017R1C1B5015353).

Conflict of interest

The authors declare no conflicts of interest

CRediT author statement

YJY: Conceptualization, Software; HL and KTK: Methodology, EJL: Data curation, Writing- Original draft preparation. EJL and YJY: Visualization, Investigation; YJY: Supervision, Writing- Reviewing and Editing.

Supplementary Material

Add short descriptions of supplementary material. This material is available online at www.eaht.org.

Table S1.

The identified gene names and accession numbers containing differentially methylated cytosine.

eaht-40-Special_Issue-e2025s05-Supplementary-Table-S1.pdf

References

1. Poole A, van Herwijnen P, Weideli H, Thomas MC, Ransbotyn G, Vance C. Review of the toxicology, human exposure and safety assessment for bisphenol A diglycidylether (BADGE). Food Addit Contam 2004;21(9):905–919. http://doi.org/10.1080/02652030400007294.
2. Lyons G. Bisphenol A: A known endocrine disruptor. [cited Mar 5, 2010]. Available from: https://wwfeu.awsassets.panda.org/downloads/bisphenol.pdf.
3. Dionisi G, Oldring PKT, ; Joint Industry Group (JIG). Estimates of per capita exposure to substances migrating from canned foods and beverages. Food Addit Contam 2002;19(9):891–903. http://doi.org/10.1080/02652030210151868.
4. Boogaard PJ, de Kloe KP, Bierau J, Kuiken G, Borkulo PE, Watson WP, et al. Metabolic inactivation of five glycidyl ethers in lung and liver of humans, rats and mice in vitro. Xenobiotica 2000;30(5):485–502. http://doi.org/10.1080/004982500237497.
5. Boogaard PJ, Denneman MA, Van Sittert NJ. Dermal penetration and metabolism of five glycidyl ethers in human, rat and mouse skin. Xenobiotica 2000;30(5):469–483. http://doi.org/10.1080/004982500237488.
6. Bentley P, Bieri F, Kuster H, Muakkassah-Kelly S, Sagelsdorff P, Stäubli W, et al. Hydrolysis of bisphenol A diglycidylether by epoxide hydrolases in cytosolic and microsomal fractions of mouse liver and skin: inhibition by bis epoxycyclopentylether and the effects upon the covalent binding to mouse skin DNA. Carcinogenesis 1989;10(2):321–327. http://doi.org/10.1093/carcin/10.2.321.
7. Climie IJ, Hutson DH, Stoydin G. Metabolism of the epoxy resin component 2,2-bis[4](2,3]epoxypropoxy)phenyl]propane, the diglycidyl ether of bisphenol A (DGEBPA) in the mouse. Part I. A comparison of the fate of a single dermal application and of a single oral dose of 14C-DGEBPA. Xenobiotica 1981;11(6):391–399. http://doi.org/10.3109/00498258109045850.
8. Climie IJ, Hutson DH, Stoydin G. Metabolism of the epoxy resin component 2,2-bis[4-(2,3-epoxypropoxy)phenyl]propane, the diglycidyl ether of bisphenol A (DGEBPA) in the mouse. Part II. Identification of metabolites in urine and faeces following a single oral dose of 14C-DGEBPA. Xenobiotica 1981;11(6):401–424. http://doi.org/10.3109/00498258109045851.
9. Vervliet P, de Nys S, Duca RC, Boonen I, Godderis L, Elskens M, et al. Human phase I in vitro liver metabolism of two bisphenolic diglycidyl ethers BADGE and BFDGE. Toxicol Lett 2020;332:7–13. http://doi.org/10.1016/j.toxlet.2020.06.022.
10. Wang L, Wu Y, Zhang W, Kannan K. Widespread occurrence and distribution of bisphenol A diglycidyl ether (BADGE) and its derivatives in human urine from the United States and China. Environ Sci Technol 2012;46(23):12968–12976. http://doi.org/10.1021/es304050f.
11. Asimakopoulos AG, Thomaidis NS, Kannan K. Widespread occurrence of bisphenol A diglycidyl ethers, p-hydroxybenzoic acid esters (parabens), benzophenone type-UV filters, triclosan, and triclocarban in human urine from Athens, Greece. Sci Total Environ 2014;470-471:1243–1249. http://doi.org/10.1016/j.scitotenv.2013.10.089.
12. Xue J, Wu Q, Sakthivel S, Pavithran PV, Vasukutty JR, Kannan K. Urinary levels of endocrine-disrupting chemicals, including bisphenols, bisphenol A diglycidyl ethers, benzophenones, parabens, and triclosan in obese and non-obese Indian children. Environ Res 2015;137:120–128. http://doi.org/10.1016/j.envres.2014.12.007.
13. Kuwamura M, Tanaka K, Onoda A, Taki K, Koriyama C, Kitagawa K, et al. Measurement of bisphenol a diglycidyl ether (BADGE), BADGE derivatives, and Bisphenol F diglycidyl ether (BFDGE) in Japanese infants with NICU hospitalization history. BMC Pediatr 2024;24(1):26. http://doi.org/10.1186/s12887-023-04493-1.
14. Kim SI, Yang YJ, Hong YP, Myung SC, Kim SC. Distribution of serum bisphenol A diglycidyl ether and its metabolite in Korean adult men and its association with reproductive hormone levels. Molecular & Cellular Toxicology 2015;11(1):71–78. https://doi.org/10.1007/s13273-015-0009-3.
15. Wang L, Xue J, Kannan K. Widespread occurrence and accumulation of bisphenol A diglycidyl ether (BADGE), bisphenol F diglycidyl ether (BFDGE) and their derivatives in human blood and adipose fat. Environ Sci Technol 2015;49(5):3150–3157. http://doi.org/10.1021/acs.est.5b00096.
16. Olea N, Pulgar R, Pérez P, Olea-Serrano F, Rivas A, Novillo-Fertrell A, et al. Estrogenicity of resin-based composites and sealants used in dentistry. Environ Health Perspect 1996;104(3):298–305. http://doi.org/10.1289/ehp.96104298.
17. Perez P, Pulgar R, Olea-Serrano F, Villalobos M, Rivas A, Metzler M, et al. The estrogenicity of bisphenol A-related diphenylalkanes with various substituents at the central carbon and the hydroxy groups. Environ Health Perspect 1998;106(3):167–174. http://doi.org/10.1289/ehp.98106167.
18. Ramilo G, Valverde I, Lago J, Vieites JM, Cabado AG. Cytotoxic effects of BADGE (bisphenol A diglycidyl ether) and BFDGE (bisphenol F diglycidyl ether) on Caco-2 cells in vitro. Arch Toxicol 2006;80(11):748–755. http://doi.org/10.1007/s00204-006-0121-1.
19. Nakazawa H, Yamaguchi A, Inoue K, Yamazaki T, Kato K, Yoshimura Y, et al. In vitro assay of hydrolysis and chlorohydroxy derivatives of bisphenol A diglycidyl ether for estrogenic activity. Food Chem Toxicol 2002;40(12):1827–1832. http://doi.org/10.1016/s0278-6915(02)00165-5.
20. Ahn SW, Nedumaran B, Xie Y, Kim DK, Kim YD, Choi HS. Bisphenol A bis(2,3-dihydroxypropyl) ether (BADGE.2H2O) induces orphan nuclear receptor Nur77 gene expression and increases steroidogenesis in mouse testicular Leydig cells. Mol Cells 2008;26(1):74–80.
21. Yang YJ, Lee SY, Kim KY, Hong YP. Acute testis toxicity of bisphenol A diglycidyl ether in Sprague-Dawley rats. J Prev Med Public Health 2010;43(2):131–137. http://doi.org/10.3961/jpmph.2010.43.2.131.
22. Hyoung UJ, Yang YJ, Kwon SK, Yoo JH, Myoung SC, et al. Developmental toxicity by exposure to bisphenol A diglycidyl ether during gestation and lactation period in Sprague-Dawley male rats. J Prev Med Public Health 2007;40(2):155–161. http://doi.org/10.3961/jpmph.2007.40.2.155.
23. Kang DW, Kwon SK, Yang YJ, Chun YJ, Hong YP. Decreased of clusterin mRNA expression of epididymis following exposure to Bisphenol A diglycidyl ether during gestation and lactation in Sprague-Dawley rats. J Environ Toxicol 2008;23(4):291–299.
24. Kwon SK, Yang YJ, Chun YJ, Hong YP. Expression of clusterin on rat epididymis exposed to bisphenol A diglycidyl during in utero and lactation. Toxicological & Environmental Chemistry 2010;92(2):315–325. https://doi.org/10.1080/02772240902846801.
25. Meehan RR, Thomson JP, Lentini A, Nestor CE, Pennings S. DNA methylation as a genomic marker of exposure to chemical and environmental agents. Curr Opin Chem Biol 2018;45:48–56. http://doi.org/10.1016/j.cbpa.2018.02.006.
26. Moore LD, Le T, Fan G. DNA methylation and its basic function. Neuropsychopharmacology 2013;38(1):23–38. http://doi.org/10.1038/npp.2012.112.
27. Cui X, Jing X, Wu X, Yan M, Li Q, Shen Y, et al. DNA methylation in spermatogenesis and male infertility. Exp Ther Med 2016;12(4):1973–1979. http://doi.org/10.3892/etm.2016.3569.
28. Aston KI, Punj V, Liu L, Carrell DT. Genome-wide sperm deoxyribonucleic acid methylation is altered in some men with abnormal chromatin packaging or poor in vitro fertilization embryogenesis. Fertil Steril 2012;97(2):285–292. http://doi.org/10.1016/j.fertnstert.2011.11.008.
29. Howe K, Clark MD, Torroja CF, Torrance J, Berthelot C, Muffato M, et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature 2013;496(7446):498–503. http://doi.org/10.1038/nature12111.
30. Cavalieri V, Spinelli G. Environmental epigenetics in zebrafish. Epigenetics Chromatin 2017;10(1):46. http://doi.org/10.1186/s13072-017-0154-0.
31. Møller L, Fotel F, Larsen P. Survey of Bisphenol A and Bisphenol-A diglycidylether polymer. [cited Feb 20, 2015] Available from: https://www2.mst.dk/udgiv/publications/2013/04/978-87-93026-14-8.pdf.
32. Yang AS, Doshi KD, Choi SW, Mason JB, Mannari RK, Gharybian V, et al. DNA methylation changes after 5-aza-2'-deoxycytidine therapy in patients with leukemia. Cancer Res 2006;66(10):5495–5503. http://doi.org/10.1158/0008-5472.CAN-05-2385.
33. Byun HM, Motta V, Panni T, Bertazzi PA, Apostoli P, Hou L, et al. Evolutionary age of repetitive element subfamilies and sensitivity of DNA methylation to airborne pollutants. Part Fibre Toxicol 2013;10:28. http://doi.org/10.1186/1743-8977-10-28.
34. Dayeh T, Volkov P, Salö S, Hall E, Nilsson E, Olsson AH, et al. Genome-wide DNA methylation analysis of human pancreatic islets from type 2 diabetic and non-diabetic donors identifies candidate genes that influence insulin secretion. PLoS Genet 2014;10(3)e1004160. http://doi.org/10.1371/journal.pgen.1004160.
35. Chen KQ, Wei BH, Hao SL, Yang WX. The PI3K/AKT signaling pathway: How does it regulate development of Sertoli cells and spermatogenic cells? Histol Histopathol 2022;37(7):621–636. http://doi.org/10.14670/HH-18-457.
36. Riera MF, Regueira M, Galardo MN, Pellizzari EH, Meroni SB, Cigorraga SB. Signal transduction pathways in FSH regulation of rat Sertoli cell proliferation. Am J Physiol Endocrinol Metab 2012;302(8):E914–923. http://doi.org/10.1152/ajpendo.00477.2011.
37. Nascimento AR, Macheroni C, Lucas TFG, Porto CS, Lazari MFM. Crosstalk between FSH and relaxin at the end of the proliferative stage of rat Sertoli cells. Reproduction 2016;152(6):613–628. http://doi.org/10.1530/REP-16-0330.
38. Xi H, Ren F, Li Y, Xian M, Wang L Hu J. FSH inhibits autophagy and lysosomal biogenesis to regulate protein degradation in cultured goat Sertoli cells. Mol Cell Endocrinol 2022;540:111505. http://doi.org/10.1016/j.mce.2021.111505.
39. He H, Li X, Shen J, Bai S, Li C, Shi H. Bisphenol A exposure causes testicular toxicity by targeting DPY30-mediated post-translational modification of PI3K/AKT signaling in mice. Ecotoxicol Environ Saf 2022;243:113996. http://doi.org/10.1016/j.ecoenv.2022.113996.
40. Lagunas-Rangel FA, Liu W, Schiöth HB. Interaction between environmental pollutants and cancer drug efficacy: Bisphenol A, Bisphenol A diglycidyl ether and Perfluorooctanoic acid reduce vincristine cytotoxicity in acute lymphoblastic leukemia cells. J Appl Toxicol 2023;43(3):458–469. http://doi.org/10.1002/jat.4398.
41. Sun XJ, Rothenberg P, Kahn CR, Backer JM, Araki E, Wilden PA, et al. Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction protein. Nature 1991;352(6330):73–77. http://doi.org/10.1038/352073a0.
42. Hunzicker-Dunn ME, Lopez-Biladeau B, Law NC, Fiedler SE, Carr DW, Maizels ET. PKA and GAB2 play central roles in the FSH signaling pathway to PI3K and AKT in ovarian granulosa cells. Proc Natl Acad Sci USA 2012;109(44):E2979–2988. http://doi.org/10.1073/pnas.1205661109.
43. Law NC, Hunzicker-Dunn ME. Insulin receptor substrate 1, the hub linking follicle-stimulating hormone to phosphatidylinositol 3-kinase activation. J Biol Chem 2016;291(9):4547–4560. http://doi.org/10.1074/jbc.M115.698761.
44. D'Cruz SC, Jubendradass R, Jayakanthan M, Rani SJA, Mathur PP. Bisphenol A impairs insulin signaling and glucose homeostasis and decreases steroidogenesis in rat testis: an in vivo and in silico study. Food Chem Toxicol 2012;50(3-4):1124–1133. http://doi.org/10.1016/j.fct.2011.11.041.
45. Wan J, Oliver VF, Wang G, Zhu H, Zack DJ, Merbs SL, et al. Characterization of tissue-specific differential DNA methylation suggests distinct modes of positive and negative gene expression regulation. BMC Genomics 2015;16(1):49. http://doi.org/10.1186/s12864-015-1271-4.
46. Irizarry RA, Ladd-Acosta C, Wen B, Wu Z, Montano C, Onyango P, et al. The human colon cancer methylome shows similar hypo- and hypermethylation at conserved tissue-specific CpG island shores. Nat Genet 2009;41(2):178–186. http://doi.org/10.1038/ng.298.
47. Zhu H, Wang G, Qian J. Transcription factors as readers and effectors of DNA methylation. Nat Rev Genet 2016;17(9):551–565. http://doi.org/10.1038/nrg.2016.83.
48. Yin Y, Morgunova E, Jolma A, Kaasinen E, Sahu B, Khund-Sayeed S, et al. Impact of cytosine methylation on DNA binding specificities of human transcription factors. Science 2017;356(6337)eaaj2239. http://doi.org/10.1126/science.aaj2239.
49. Hu S, Wan J, Su Y, Song Q, Zeng Y, Nguyen HN, et al. DNA methylation presents distinct binding sites for human transcription factors. Elife 2013;2e00726. https://doi.org/10.7554/eLife.00726.
50. Rishi V, Bhattacharya P, Chatterjee R, Rozenberg J, Zhao J, Glass K, et al. CpG methylation of half-CRE sequences creates C/EBPalpha binding sites that activate some tissue-specific genes. Proc Natl Acad Sci USA 2010;107(47):20311–20316. https://doi.org/10.1073/pnas.1008688107.
51. Medvedeva YA, Khamis AM, Kulakovskiy IV, Ba-Alawi W, Bhuyan MSI, Kawaji H, et al. Effects of cytosine methylation on transcription factor binding sites. BMC Genomics 2014;15:119. https://doi.org/10.1186/1471-2164-15-119.
52. Fürst RW, Kliem H, Meyer HHD, Ulbrich SE. A differentially methylated single CpG-site is correlated with estrogen receptor alpha transcription. J Steroid Biochem Mol Biol 2012;130(1-2):96–104. https://doi.org/10.1016/j.jsbmb.2012.01.009.
53. Weber M, Hellmann I, Stadler MB, Ramos L, Pääbo S, Rebhan M, et al. Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat Genet 2007;39(4):457–466. https://doi.org/10.1038/ng1990.
54. Boyes J, Bird A. Repression of genes by DNA methylation depends on CpG density and promoter strength: evidence for involvement of a methyl-CpG binding protein. EMBO J 1992;11(1):327–333. https://doi.org/10.1002/j.1460-2075.1992.tb05055.x.
55. Siegfried Z, Simon I. DNA methylation and gene expression. Wiley Interdiscip Rev Syst Biol Med 2010;2(3):362–371. https://doi.org/10.1002/wsbm.64.
56. Lan HC, Wu KY, Lin IW, Yang ZJ, Chang AA, Hu MC. Bisphenol A disrupts steroidogenesis and induces a sex hormone imbalance through c-Jun phosphorylation in Leydig cells. Chemosphere 2017;185:237–246. https://doi.org/10.1016/j.chemosphere.2017.07.004.
57. Nanjappa MK, Simon L, Akingbemi BT. The industrial chemical bisphenol A (BPA) interferes with proliferative activity and development of steroidogenic capacity in rat Leydig cells. Biol Reprod 2012;86(5):135. 1-12. https://doi.org/10.1095/biolreprod.111.095349.
58. Manna PR, Chandrala SP, King SR, Jo Y, Counis R, Huhtaniemi IT, et al. Molecular mechanisms of insulin-like growth factor-I mediated regulation of the steroidogenic acute regulatory protein in mouse leydig cells. Mol Endocrinol 2006;20(2):362–378. https://doi.org/10.1210/me.2004-0526.
59. Seto-Young D, Avtanski D, Strizhevsky M, Parikh G, Patel P, Kaplun J, et al. Interactions among peroxisome proliferator activated receptor-gamma, insulin signaling pathways, and steroidogenic acute regulatory protein in human ovarian cells. J Clin Endocrinol Metab 2007;92(6):2232–2239. https://doi.org/10.1210/jc.2006-1935.
60. Manikandan P, Nagini S. Cytochrome P450 structure, function and clinical significance: A review. Curr Drug Targets 2018;19(1):38–54. https://doi.org/10.2174/1389450118666170125144557.
61. Rajapaksha M, Thomas JL, Streeter M, Prasad M, Whittal RM, Bell JD, et al. Lipid-mediated unfolding of 3β-hydroxysteroid dehydrogenase 2 is essential for steroidogenic activity. Biochemistry 2011;50(51):11015–11024. https://doi.org/10.1021/bi2016102.
62. Mindnich R, Möller G, Adamski J. The role of 17 beta-hydroxysteroid dehydrogenases. Mol Cell Endocrinol 2004;218(1-2):7–20. https://doi.org/10.1016/j.mce.2003.12.006.
63. Oliveira CA, Mahecha GA, Carnes K, Prins GS, Saunders PTK, França LR, et al. Differential hormonal regulation of estrogen receptors ERalpha and ERbeta and androgen receptor expression in rat efferent ductules. Reproduction 2004;128(1):73–86. https://doi.org/10.1530/rep.1.00136.
64. Scientific Committee on Food (SCF). Opinion on bisphenol a diglycidyl ether (BADGE). [cited Feb 6, 2007]. Available from: http://eceuropa.eu./food/fs/sc/saf/out28_en.pdf.
65. The Scientific Committee on Toxicity, Ecotoxicity, and the Environment (CSTEE). Two study reports on endocrine disruptors by WRc-NSF and BKH consulting engineers. [cited Feb 6, 2007]. Available from: http://ec.europa.eu/health/archive/ph_risk/committees/sct/documents/out208_en.pdf.

Article information Continued

Figure 1.

Hypometylation and hypermethylation per chromosome in zebrafish gonad exposed to BADGE 10uM during 21 days. Cutoff for differentially methylated sites is q-value <0.01, p<0.05, and within <1000 bp.

Figure 2.

The difference of methylation of identified genes in zebrafish gonad exposed to BADGE 10uM during 21 days.

Figure 3.

The mRNA expressions of commonly identified differentially methylation regions in zebrafish gonad exposed to BADGE 10uM during 21 days.

Figure 4.

The mRNA expressions of steroidogenic enzymes including steroidogenic acute regulatory (star), cytochrome P450 family 11 subfamily A member 1 (cyp11a1), cytochrome P450 family 17 subfamily A member 1 (cyp17a1), hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 (hsd3b2), and hydroxysteroid 17-beta dehydrogenase 1 (hsd17b1), as well as estrogen receptor 1 (esr1), were in zebrafish gonad exposed to BADGE 10uM during 21 days.

Table 1.

Primer sequences used for qRT-PCR amplification.

Gene ID Accession No. Forward Product size (bp)
Identified genes pik3cb NM_201143 F: CGAGTATGTCTGCGTCTCAGTTA 137
R: TCCTGCTCGAACCTGGATCTTA
pik3cg NM_213306 F: AAAGTGTGTCAATGAGGACAAGCA 152
R: CAATGTGGAAGAGATTACCTGTCT
pik3r3b XM_005157466 F: CATGTATCCGGTCTCCCGCT 175
R: GGTACGTTTCATCTGGATCTCCT
insra XM_005171260 F: GGAGATCAGGCTTCATGTGAGA 164
R: TCAGTCACGTTCTTATATGGTGCT
irs1 XM_682610 F: CTAATGCAGAATGGAGAGCAACAT 182
R: CGGCGGATTTTTACTCTTCATTCTT
Steroidogenic enzymes star NM_131663 F: CAATGTCAAGCAAGTCAAGATTCTT 218
R: GTCCATTCTCAGCCCTTACAAA
cyp11a1 NM_152953 F: AGGGGTGGACTCGGTTACTT 198
R: ATTGCTACAGGATGTAATCTGAGA
cyp17a1 NM_212806 F: GATATTTTCCCATGGCTGCAGAT 199
R: CACGAGTGCTGCTGTTATTGTTT
hsd3b2 NM_212797 F: GAGGACTCGACACGGGCTTT 205
R: TAGTCTCTCCACGGCCATCC
hsd17b1 NM_205584 F: CAGAATTGACATACTGGTGTGTAA 212
R: CGTTGAATGGCAAACCCTGC
Estrogen receptor esr1 NM_152959 F: CATACTCATCAATTCTGGTGCATT 219
R: TGCTCCATTCCTTTGTTGCTCAT
Reference genes gapdh NM_001115114 F: GTAATTCCTGAGCTCAATGGCAA 204
R: ATTGAAGTCAGTGGACACAACCT
β-actin NM_131031 F: TTCCTTCCTGGGTATGGAATCTT 199
R: AATGATCTTGATCTTCATGGTGGAA
rplp0 NM_131580 F: AACCATTGAAATCTTGAGTGACGTT 210
R: CTCACACCCTCCAGGAATCT

pik3cb: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta, pik3cg: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma, pik3r3b: phosphoinositide-3-kinase regulatory subunit 3b (gamma), insra: insulin receptor A, irs1: insulin receptor substrate 1, star: steroidogenic acute regulatory, cyp11a1: cytochrome P450 family 11 subfamily A member 1, cyp17a1: cytochrome P450 family 17 subfamily A member 1, hsd3b2: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2, hsd17b1: hydroxysteroid 17-beta dehydrogenase 1, esr1: estrogen receptor 1, gapdh: glyceraldehyde-3-phosphate dehydrogenase, rplp0: ribosomal protein lateral stalk subunit 0, F: Forward primer; R: Reverse primer.

Table 2.

Enriched KEGG pathways for genes containing differentially methylated cytosines in the testis of BADGE exposed adult male zebrafish.

KEGG pathway Count p-value Gene name
Phosphatidylinositol signaling system 17 0.001486 Pip4p1a, pip4p1a, ip6k2b, pik3r3b, ip6k2a, pi4k2b, dgki, pik3cg, plcb3, inpp5ka, inpp5l, itpkb, pikfyve, pik3cb, plcd3b, inpp5b, mtmr1b, pip5k1ca
Inositol phosphate metabolism 14 0.002012 pi4k2b, plch2a, miox, pik3cg, plcb3, inpp5ka, inpp5l, itpkb, pikfyve, pik3cb, plcd3b, inpp5b, mtmr1b, pip5k1ca
Cardiac muscle contraction 13 0.019472 uqcr10, cacna1c, tpm3, tpm3, cacng6a, cacng2a, tpm4a, cacnb2a, zgc:86599, cacna2d1a, fxyd2, cacnb1, cox6c, cox5ab
Insulin resistance 16 0.023100 slc27a4, pik3r3b, irs1, tbc1d4, ppp1r3da, creb3l3a, prkcz, srebf1, pik3cg, prkag2b, insra, g6pca.2, prkab1b, ogt.2, pik3cb, pck2
Insulin signaling pathway 19 0.027132 raf1b, pik3r3b, badb, socs2, irs1, ppp1r3da, prkcz, srebf1, pik3cg, prkag2b, insra, g6pca.2, eif4e2, prkab1b, phkg1b, pik3cb, phka2, hrasb, pck2
FoxO signaling pathway 18 0.045318 usp7, raf1b, pik3r3b, s1pr1, irs1, mapk14a, il7r, ccnb2, prmt1, pik3cg, prkag2b, insra, g6pca.2, prkab1b, stk11, pik3cb, hrasb, pck2

KEGG: Kyoto encyclopedia of genes and genomes, BADGE: Bisphenol A diglycidyl ether.