Astaxanthin ameliorates necroptosis through bisphenol-A exposure by regulating brain RIPK1/FADD/RIPK3/MLKL pathway in adult male rats

Article information

Environ Anal Health Toxicol. 2025;40.e2025024
Publication date (electronic) : 2025 September 24
doi : https://doi.org/10.5620/eaht.2025024
1Department of Laboratory Medical Sciences, Al-Aqsa University, Mustafa Hafez St., Gaza, Palestine
2Faculty of Medicine, Al Azhar University, Jamal Abdl Naser St., Gaza, Palestine
3Mammalian Toxicology Department, Central Agricultural Pesticides Laboratory, Agricultural Research Center, Dokki, Giza, Egypt
4Department of Chemistry, College of Science, King Khalid University, Abha, 61413, Saudi Arabia
5Pesticide Formulation Department, Central Agricultural Pesticide Laboratory, Agricultural Research Center, Dokki, Giza, Egypt
6Egyptian Center for Disease Control (CDC), National Hepatology and Tropical Medicine Research Institute (NHTMRI), Corniche El Nil - Imbaba – Giza, Egypt
Received 2025 April 7; Accepted 2025 August 27.

Abstract

Bisphenol A (BPA), a common endocrine-disrupting chemical, can cause oxidative damage, apoptosis, and necroptosis in various organs. However, the underlying mechanisms for BPA-induced neurotoxicity were not properly reported. Here, we have evaluated the possible ameliorative roles of astaxanthin (ASX) against BPA-induced brain apoptosis/necroptosis in male rats. Forty male rats were equally grouped (30 days) into control, ASX (75 mg/kg), BPA (50 mg/kg), and BPA/ASX (50 mg/kg/BAP+75 mg/kg/ASX). The present findings demonstrated that ASX could mitigate the diminished acetylcholinesterase (AchE) activity and the increased dopamine, serotonin, and norepinephrine levels, besides anxiety behaviors that resulted from BPA intoxication. Furthermore, ASX significantly reduced BPA-induced brain oxidative injury by mitigating malondialdehyde (MDA), glutathione (GSH), glutathione transferase (GST), superoxide dismutase (SOD), and catalase (CAT) levels. Moreover, ASX could alleviate the histopathological changes promoted by BPA and repair the transcript levels of p53, BcL2, caspase9, FADD, RIPK1/3, MLKL along with Bax, and caspase3 immunoreactivity. In conclusion, ASX reserved brain injury-induced apoptosis, and necroptosis following exposure to BPA through p53/Bcl2/Bax/caspase9/capasase3 and RIPK1/FADD/RIPK3/MLKL pathways.

Introduction

Bisphenol A (BPA), is an industrial chemical, found in consumer products such as food and beverage containers, medical devices, and electronics. Exposure to BPA affects brain development and function, leading to stricter regulations to protect public health [1]. Moreover, BPA can be ingested as it is used in polycarbonate plastics and epoxy resins, which lead to numerous health risks such as endocrine disruption, obesity, diabetes, reproductive disorders, and increased risk of cancer, heart disease, and chronic illnesses [2].

Although the exact mechanism by which BPA causes brain damage is not yet understood, research suggests that it may trigger cell death forms. In this respect, BPA exposure has been linked to oxidative stress (OS), which leads to cellular damage and death, contributing to the overall negative impact of BPA on the brain [3]. Additionally, increased levels of apoptosis and necroptosis have been observed in studies involving exposure to BPA [4]. Necroptosis is a type of programmed cell death stimulated by the activation of death receptors. It is important in controlling infection, inflammation, and tissue damage [5]. Recently, necroptosis has drawn a lot of attention in biomedical research circles, it is primarily dependent on receptor-interacting protein kinase 1 (RIPK1), receptor-interacting protein kinase 3 (RIPK3), and mixed lineage kinase domain-like (MLKL) signaling [6].Through their mutual interactions, RIPK1 and RIPK3 produce a functional heterodimer complex that phosphorylates MLKL to encourage oligomerization. When the oligomeric form of MLKL moves from the cytosol to the plasma membrane, a pore forms, and an inflammatory response is triggered. Also, MLKL mediates its action after interacting with ion channels and despite pore formation [7].

Aquatic animals, yeast, algae, and other microbes all contain the red carotenoid astaxanthin (ASX). It is utilized in the food, feed, cosmetics, and nutraceutical industries. It is a fat-soluble pigment that does not contain pro-vitamin A action in the human body. ASX is 100 times more effective than α-tocopherol and 10 times stronger than zeaxanthin, lutein, canthaxanthin, and β-carotene, despite some research suggesting that it has more intense biological action than other carotenoids [8]. There is growing evidence that ASX can inhibit the development of oxidative stress-associated diseases and mitochondrial dysfunction. Additionally, its powerful permeation through the blood-brain barrier [9] allows ASX to act as a potent neuroprotective agent in mammals. Furthermore, ASX's lipophilic, hydrophilic structure, antioxidant capacity, and intracellular absorption capacity make it a superior antioxidant in many ways compared to other antioxidants [10].

Regarding neurological protection, ASX has been discussed about neurological conditions such as neuropathic pain, Parkinson's disease, Alzheimer's disease, cerebral ischemia, and autism. Moreover, ASX has gained significant interest in recent years, and its supplementation has been investigated in a broad range of clinical trials for its potential therapeutic use in neurological and neuroinflammatory diseases [11]. While the exact mechanisms by which ASX provides these protective effects are still not fully understood, research suggests that it may do so by reducing oxidative stress and inflammation. So, this study aims to study the protective role of ASX against BPA-induced oxidative stress, apoptosis, and necroptosis in male rats' brains through the FADD/RIPK1/RIPK3/MLKL pathway.

Materials and Methods

Chemicals

BPA (CAS Number 80-05-7; molecular weight 228.29 g/mol; Purity (HPLC) > 99.0 %), ASX (CAS Number 7542-45-2; molecular weight 596.84 g/mol; Purity (HPLC) > 97.0 %), and other chemicals of analytical grades were purchased from Sigma-Aldrich (USA).

Animals & experimental plan

Forty male rats, Rattus norvegicus, weighing 160 ± 10 grams were divided into four groups. Group 1 served as the control and received corn oil 1 ml/kg body weight. Group 2 received 75 mg/kg of ASX [12]. Group 3 received 50 mg/kg of BPA [13]. Group 4 received 75 mg/kg of ASX and 50 mg/kg of BPA. All rats received oral gavage treatment for 30 days and were kept under normal dietary conditions with a 12-hour light and 12-hour dark cycle at a consistent temperature of 24°C with a relative humidity of 42 ± 5%. The health and well-being of the rats were closely monitored during the study and the study was approved by Al-Aqsa University (MLS/D/12/22).

Sample collection

After the exposure period, the animals were euthanized and sacrificed, and their brains were collected. A part of the brain tissues was preserved in 10% formalin for histological and immunohistochemical analysis. The remaining brain tissues were stored at -80°C for neurotransmitters, redox biomarkers, and gene expression analysis.

Open field test (OFT)

An apparatus made of Teflon that measured 100 cm by 100 cm and had walls that were 30 cm was used for the open field test. The floor was divided into 100 (10 cm × 10 cm) squares by red lines, while the walls and floor were also white. Additionally, a 25 cm by 25 cm central square was drawn in the center of the open field to gauge anxiety-like behavior [14]. The base of their tails always handled rats, and they were chosen at random from their home cages to be positioned in one of the four open field corners that faced the central arena. The rats' activity (latency, ambulation, and rearing) and emotionality behavior (grooming) were evaluated during the three-minute test, which took place between 6:00 and 7:00 a.m. The rats were put back in their cages after the test, and the equipment was cleaned with 70% ethyl alcohol and left to dry in between tests.

Neurotransmitters estimation

The brain tissues were homogenized in potassium phosphate buffer solution and the protein concentration was measured using the Bradford method [15]. The brain serotonin, dopamine, and norepinephrine levels were measured using enzyme-linked immunosorbent assay kits from Aviva Systems Biology (San Diego, USA). Acetylcholinesterase (AchE) activity was determined using a colorimetric method and acetylthiocholine iodide as a substrate [16].

Oxidant/antioxidant assays

The thiobarbituric acid assay was used to measure the amount of brain malondialdehyde (MDA) as previously explained by Garcia et al. [17]. The Ellman [18] method was used to measure the amount of reduced glutathione (GSH). The previous reports by Habig et al. [19], Marklund and Marklund [20], and Aebi [21] were used to assess the activity of glutathione-S-transferase (GST), superoxide dismutase (SOD), and catalase (CAT), respectively.

Histopathological and immunohistochemistry examinations

Paraffin-embedded brain tissue from each rat was cut into 3-5 μm slices and stained with hematoxylin and eosin (H&E) for histological analysis [22]. Kim et al. [23] method was used to conduct the immunohistochemistry analysis. Horseradish peroxidase-conjugated streptavidin and a biotinylated secondary antibody were added after the primary antibodies of rabbit anti-caspase3 and anti-Bax (Abcam, Ltd.) were utilized. A light microscope with a digital camera was used to analyze the samples. We assessed the integrated intensity of immunostaining in the brain tissue using imaging software (ImagePro Plus 7.0, Media Cybernetics, USA) to measure these proteins' expression.

Gene expression study

Total RNA was extracted from brain tissues following the guidelines provided by the RNeasy Mini kit's manufacturer (Qiagen, Germany). A260/A280 ratios were then measured using Nanodrop 8000 (Thermo Scientific, USA) to ascertain the extracted RNA's concentration and purity. The Revert Aid Reverse Transcriptase (Thermo Fisher) was used to reverse transcript the isolated RNA. Real-time PCR with the SYBR Green PCR Master Mix (Qiagen, Germany) and particular primers indicated in Table 1 were used to measure the mRNA expression. The Stratagene MX3005P software (Agilent Technologies, GmbH) was used to quantify the mRNA. Using the technique of Yuan et al. [24], the mRNA levels were standardized to a housekeeping gene, β-actin, to guarantee reliable comparison between samples.

Primer sequences used in SYBR Green RT-PCR.

Statistical analysis

SPSS (version 25.0, IBM SPSS Inc., USA) software was used to do statistical analysis. The mean (M) ± standard error of the mean (SEM) is how the findings are displayed. A one-way analysis of variance (ANOVA) was conducted for statistical analysis, with a significance level of p ≤ 0.05. Graph visualizations were created using GraphPad Prism Software (version 10.4.0).

Results

Open field parameters

Table 2. shows that BPA exposure significantly increased the rearing behavior by 121.8% compared to the control group (p < 0.05; F = 19.3). The grooming was also significantly increased by 255.7% in the BPA group compared to the control group (p < 0.05; F = 8.1). Similarly, the time spent in the central arena was significantly increased by 191.2% (p < 0.05; F = 5.4), but the defecation behavior was not significantly different between the two groups (p > 0.05; F = 1.7). On the other hand, when the BPA-exposed rats were treated with ASX, the rearing behavior was significantly alleviated by 32.2 % compared to the BPA group. Similarly, the grooming and time spent in the central arena were significantly reduced by 47.4% and 30.1%, respectively, (p < 0.05).

The impact of ASX on behavioral responses of the BPA-exposed rats.

Neurotransmitter levels

The data in Table 3 shows that the level of dopamine in the BPA group was significantly higher than the control group by 69.24% (p < 0.05, F = 42.1). The same pattern was observed in norepinephrine and serotonin, where in the BPA group their level was 80.3% (p < 0.05; F = 22.7) and 72.1% (p < 0.05; F = 38.2) significantly higher than the control group, respectively. The activity of AchE in the BPA group was significantly reduced by 35.6% compared to the control group (p < 0.05). In the ASX/BPA group as compared with the BPA group; dopamine level was significantly lower by a 27.5% decrease, norepinephrine level was lower by a 23.7% decrease, and serotonin level by a 43.5% decrease, but all still higher than the control group (p < 0.05). The activity of AchE was increased in the ASX/BPA group compared to the BPA group, with a 19.2% increase, but still lower than the control group (p < 0.05). So, the co-treatment with ASX could revert levels of dopamine, norepinephrine, serotonin, and the activity of AchE to near-normal values, although still significantly different from the control group (p < 0.05).

The impact of ASX brain neurochemical parameters of the BPA-exposed rats

Oxidant/antioxidant levels

The results presented in Table 4 show that in rats treated with BPA, the level of the brain MDA significantly increased by 108.4% compared to the control group (p < 0.05; F = 42.6), while the level of GSH decreased by 40.6% (p < 0.05; F = 19.1). Additionally, the activities of three antioxidants enzyme (GST, SOD, and CAT) were significantly decreased in the brain of BPA-treated rats by 44.9%, 58.7%, and 56.2%, respectively (p < 0.05; F = 83.8, 25.4 and 4.2 respectively). However, the ASX/BPA treatment significantly reduced the level of MDA by 28.03% and increased the level of GSH by 24.6% compared to the BPA group (p < 0.05). Furthermore, the antioxidant activities of GST, SOD, and CAT in the ASX/BPA group were significantly increased by 35.3%, 38.5%, and 84.4%, respectively compared to the BPA group (p < 0.05). The co-treatment with ASX could direct the levels of MDA, GSH, and GST to near-normal values (p < 0.05), and could normalize SOD and CAT activities (p >0.05).

Protective effects of ASX against the BPA-induced variations in the rats brain oxidative/antioxidative parameters.

Histological observations

The histological examination of brain sections from the control and ASX groups (Figure 1. A and 1. B) revealed that the cerebellar cortex consists of three layers: an outer molecular layer (ML), a middle Purkinje cell layer (PL), and an inner granule cell layer (GL). The Purkinje cell layers are composed of large, flask-shaped cells with a large nucleus and granular cytoplasm, while the granule cell layer is densely populated with clusters of granule cells. In the BPA-intoxicated group (Figure 1. C), the brain sections showed signs of degeneration, including degradation of Purkinjean cells (zigzag arrow) and vacuolation (V). However, co-treatment with ASX (Figure 1. D) was found to counteract most negative effects of BPA on brain tissue, as evidenced by the normalization of histopathological changes observed in the brain sections.

Figure 1.

Alleviation efficiency of ASX against BPA-induced histopathological changes in the brain tissue. (A) Control group, (B) ASX group, (C) BPA group, and (D) ASX/BPA group.

Relative quantity of mRNA gene expression

The BPA group demonstrated a significant increase in the mRNA gene expression (p ˂ 0.05) of p53 (4.67-fold; F = 6.51), caspase9 (7.67-fold; F = 9.8), FADD (5.73-fold; F = 14.7), RIPK1 (3.97-fold; F= 4.1), RIPK3 (5.7-fold; F = 9.7), and MLKL (5.6-fold; F = 11.1) compared to the control group (Figure 2). However, the BPA group also demonstrated a significant decrease in the mRNA gene expression of Bcl-2 compared to the control group (0.48-fold; F = 4.47). Notably, the mRNA gene expression was significantly different in the ASX/BPA group compared to the BPA group (lower for p53, caspase9, FADD, RIPK1, RIPK3, and MLKL, and higher for Bcl2; p-value<0.05), indicating that ASX treatment was able to mitigate the altered gene expression caused by BPA exposure.

Figure 2.

Alleviation efficiency of ASX against BPA-induced alterations in the brain transcript levels of p53 (A), Bcl2 (B), caspase-9 (C), FADD (D), RIKP1 (E), RIKP3 (F), and MLKL (G) in male rats. Each value represents the mean ± SEM. Means with different letters indicated the variations between the groups within the same column using Tukey’s honestly significant difference (p < 0.05) test.

Immunohistochemical analysis for Bax and caspase3

The levels of Bax (Figure 3) and caspase3 (Figure 4) proteins were analyzed through immunohistochemical analysis in brain tissue samples from control (Figure 3. A and 4. A), ASX (Figure 3. B and 4. B), BPA (Figure 3. C and 4. C), and ASX/BPA (Figure 3. D and 4. D) groups. Negative staining was observed in the control and ASX groups, whereas positive staining for active Bax and caspase3 was observed in the BPA group. The intensities of active Bax and caspase3 highly increased compared with control (p < 0.05) which were 439% and 523%, respectively. However, ASX significantly reduced the level of Bax and caspase3 expression in the BPA-ASX group (p<0.05) by 59% and 64%, respectively

Figure 3.

Photomicrographs of brain sections stained for Bax protein expression using an immunohistochemical technique. Control group (A), ASX group (B), BPA group (C), and ASX/BPA group (D). Each value of the immune area represents the mean ± SEM. Means with different letters indicated the variations between the groups within the same column using Tukey’s honestly significant difference (p < 0.05) test (E).

Figure 4.

Figure Photomicrographs of brain sections stained for caspase-3 protein expression using an immunohistochemical technique. Control group (A), ASX group (B), BPA group (C), and ASX/BPA group (D). Each value of the immune area represents the mean ± SEM. Means with different letters indicated the variations between the groups within the same column using Tukey’s honestly significant difference (p < 0.05) test (E).

Discussion

Recently, BPA has had the potential to damage neuro-cell junctions, penetrate the blood-brain barrier, and accumulate in the brain, potentially causing an imbalance of brain protein interactions and modifications, leading to neurodegeneration and abnormal brain development [25]. Therefore, this study aimed to investigate the protective role of ASX against BPA-induced apoptosis and necroptosis in male rats' brains focusing on the FADD/RIPK1/RIPK3/MLKL signaling pathway.

According to our results, exposure to BPA significantly increased the brain's dopamine, norepinephrine, and serotonin levels. Recent studies have shown that BPA exposure can affect the levels of neurotransmitters, particularly dopamine, norepinephrine, and serotonin [1]. These neurotransmitters are crucial for the regulatory function of the central nervous system, and any alteration in their levels may result in neurodegenerative disorders [26]. One possible explanation for how BPA affects neurotransmitters is inhibiting the enzyme AchE, via OS mediator [27], such as hydroxyl radicals [28]. Therefore, we may claim that inhibition of AchE activity in the present study is linked to the state of OS caused by BPA in the rat brain (Figure 5).

Figure 5.

Graphic abstract of BPA-induced apoptosis, necroptosis and neurobehavioral deficient of brain of mature rats and the protective effect of ASX: it is proposed that BPA pass the cell membrane increase the ROS formation and cause lipid peroxidation (MDA) [36] this cause oxidative damage, depleting cellular antioxidants (GSH, GST, SOD &CAT), inhibition of AchE enzyme, increasing levels of neurotransmitters (dopamine, serotonin and norepinephrine) that responsible for anxiety behaviors [32]. ROS also cause DNA damage that activates p53 that declines anti-apoptotic Bcl-2 and enhances BAX that activate mitochondria to release cytochrome c then caspase-9 is activated that activates caspase-3 and then apoptosis process [44]. On the other hand, BPA induced increase of inflammatory cytokines that activates death receptors, activating RIPK1, RIPK3 and MLKL that activating programmed necrosis (necroptosis) [38]. Beside this RIPK1 extrinsic apoptosis pathway by activating FADD that in turn activates caspase cascade till caspase-3. ASX reverting this process by decreasing oxidative stress and inflammation [48].

Notably, the inhibition of AchE activity can result in an overabundance of acetylcholine at the synaptic cleft, leading to overstimulation of both nicotinic and muscarinic cholinergic receptors [29]. This overstimulation can cause an increase in dopamine levels in the brain through a complex interaction between acetylcholine receptors and dopamine signaling, involving regulation at both pre- and postsynaptic levels [30]. Another potential reason for the increased dopamine levels resulting from BPA exposure is a non-genomic activation of tyrosine hydroxylase by estrogenic pollutants. BPA can boost the activity of dopamine production enzymes, such as tyrosine hydroxylase and dopamine β-hydroxylase. While also inhibiting the activity of enzymes like monoamine oxidase which breaks down those neurotransmitters to prevent any overreaction [31]. Therefore, the elevated dopamine, norepinephrine, and serotonin levels observed in our study may result from BPA's effects on those enzymes, especially monoamine oxidase which may recruit neurotoxic effects [32].

Interestingly, we found that co-treatment with ASX reversed the AchE activity changes. This mitigation may result from ASX's capacity to improve serotoninergic and dopaminergic neuron function via a receptor-based mechanism that controls the sensitivity of serotonin and dopamine receptors and modifies the synthesis and release of neurotransmitters, thereby lowering neurotransmitter levels. [33]. Additionally, ASX may reverse AchE's inhibition, bringing the synaptic cleft's acetylcholine levels back to normal [34].

The investigation results conclusively demonstrate that exposure to BPA elicits anxiety-like behavior in rats, as evidenced by a significant augmentation in the frequency of rearing, grooming, and central arena occupancy relative to the control group. These behavioral modifications can be attributed to the impact of BPA on dopamine and norepinephrine, which are vital in motor activity and arousal. This finding is consistent with previous studies utilizing the elevated plus maze, a widely accepted behavioral test [25]. Compared to the BPA group, the co-administration of ASX led to a significant decrease in central, grooming, and rearing behaviors. The protective effect of ASX on the dopaminergic and noradrenergic systems may cause this reduction. [35], as evidenced by the decrease in the content of dopamine and norepinephrine in the ASX/BPA group. However, it's crucial to remember that these levels were still higher than those in the control group. These results suggest that ASX partially mitigates the adverse effects of BPA on the dopaminergic and noradrenergic systems, leading to a decrease in rearing, grooming, and central behaviors in the ASX/BPA group (Figure 5).

The study findings demonstrated that rats exposed to BPA had decreased antioxidant activity, increased MDA levels, and decreased GSH levels (GST, SOD, and CAT). On the other hand, the co-treatment of rats with ASX showed a significant decrease in the level of MDA an increase in the level of GSH, and improved antioxidant activities in the brain compared to the BPA group. These findings support the notion that the alterations in the redox status may play a crucial role in the neurotoxicity of BPA and histopathological findings. The high quantity of MDA, a consequence of lipid peroxidation, suggests that BPA can cause OS in the brain by being transformed into reactive oxygen species (ROS) by phase I enzymes [36]. Moreover, BPA may accumulate in the mitochondria and inhibit complex I of the respiratory chain, increasing ROS levels [37]. This ROS can reduce antioxidant enzyme activities, increase membrane permeability, and induce oxidative damage. However, the primary antioxidant, GSH, has a complementary role with its related enzymes in neutralizing the effects of BPA, its levels can decrease due to the large amounts used to combat BPA-induced ROS damage [38]. The decreased GSH level can decrease the enzymatic activity of GPx and GST [39]. The attraction of mitochondria by BPA may also increase oxidative phosphorylation and reduce SOD and CAT activities. According to [40], GPx has a quicker rate of hydrogen peroxide elimination than CAT, which could account for the decline in GPx and CAT activities after BPA exposure (Figure 5).

Notably, the protective effect of ASX against variations caused by BPA exposure may be due to its reduction of lipid peroxidation and enhancement of the redox status. The antioxidant capabilities of ASX are facilitated by its chemical structure which contains polar hydroxyl and carbonyl-containing ionone rings, enabling it to scavenge free radicals effectively. This scavenging activity of ASX contributes to a reduction in lipid peroxidation, leading to a decrease in the levels of MDA and an increase in GSH content and antioxidant enzyme activity [41]. Additionally, ASX can encourage the biological system to recover from GSH depletion by modulating the redox sequence of GSH [42]. Furthermore, a major contributor to ASX's neuroprotective function is stimulating the nuclear factor erythroid 2 (Nrf2) pathway. According to [43], this activation can migrate Nrf2 into the nucleus, which interacts with antioxidant response elements and initiates the transcriptional activation of antioxidant enzymes. Thus, ASX may protect mitochondrial dysfunction by increasing cellular antioxidant capacity and lowering BPA-induced oxidative damage in the brain.

Our findings indicate that BPA exposure up-regulated p53, caspase9, RIPK1, RIPK3, MLKL, and FADD gene expressions, but down-regulated Bcl-2 gene expression. Furthermore, the active Bax and caspase3 protein levels increased in the brain tissue. This activation of apoptotic and necroptotic pathways is likely attributed to OS caused by BPA, leading to the accumulation of ROS, this excessive ROS cause DNA damage that activates p53 which in turn declines anti-apoptotic Bcl-2 and enhances pro-apoptotic BAX that activates mitochondria to release cytochrome c then caspase9 is activated that activates caspase3 and then apoptosis process [44]. The activated caspase3 is the essential apoptotic protein that can start an apoptotic signal transduction cascade and cause DNA damage by enhancing the caspase-activated DNases. Additionally, we observed that increased gene expression of RIPK1 and FADD in the BPA-intoxicated group indicated elicitation of apoptotic extrinsic pathway through activation death receptors till caspase cascades. It was observed that BPA could induce an increase of inflammatory cytokines that activate death receptors [38], activating RIPK1 this active RIPK1 extrinsic apoptosis pathway by activating FADD that in turn activates caspases cascade till caspase3 [6]. We also noticed the increased RIPK3, and MLKL gene expression due to BPA exposure thus these are signs of necroptosis activation. Necroptosis is characterized by activating the necrosis factors, mainly RIPK1, RIPK3, and MLKL. RIPK1 activated RIPK3, its activation leading to the phosphorylation of MLKL and the eventual initiation of necroptosis [45]. Therefore, BPA exposure has been shown to promote the expression of RIPK1 and RIPK3, thus activating the necroptosis pathway [46].

Our research found that ASX could decrease the apoptosis process via the reduction expression of pro-apoptotic genes (p53, caspase9, Bax, and caspase 3 besides RIPK1, FADD,) stimulated by BPA while increasing the expression of the anti-apoptotic gene Bcl-2. Additionally, ASX alleviated the expression of RIPK3 and MLKL thus decreasing the necroptosis process this was observed in the alleviation of the architecture of the ASX-treated cells histology. This mainly may be due to the strong antioxidant function of ASX that decreases ROS and OS as shown in our results via reduced lipid peroxidation and alleviation of brain antioxidants besides its anti-inflammation properties that concluded in many studies by decreasing TNF-α and IL-6 [47]. These findings confirmed the neuroprotective properties of ASX against various neurotoxicants, including BPA [48] by decreasing oxidative stress/apoptosis/necroptosis (Figure 5).

Conclusions

Our results provide insight into the complex mechanisms through which BPA exposure affects the apoptosis and necroptosis signaling pathways, and how ASX treatment may mitigate these effects. The alleviation of ASX could be supported by safeguarding mitochondrial function to regulate redox balance that alleviates anxiety behavior, apoptosis, and necroptosis via the FADD/RIPK1/RIPK3/MLKL pathway. Further studies are needed to comprehend this mechanism and exhaustively determine the potential therapeutic applications of ASX for protecting against BPA toxicity.

Notes

Acknowledgement

This work was supported by College of Science-King Khalid University, Faculty of Medicine-Al Azhar University and Department of Laboratory Medical Sciences-Al-Aqsa University. The authors are also highly indebted to the support of the Central Agricultural Pesticides Laboratory-Agricultural Research Center and Egyptian Center for Disease Control-National Hepatology and Tropical Medicine Research Institute.

Conflict of interest

No potential conflict of interest was reported by the authors.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Ethical approval

The experimental work was performed according to the guidance for care and use of laboratory animals and this study was approved by Al-Aqsa University (MLS/D/12/22).

CRediT author statement

ME: Resources, Methodology, Data curation, Formal analysis, Software, Investigation, Validation, Visualization; KAI: Conceptualization, Project administration, Resources, Methodology, Data curation, Formal analysis, Software, Investigation, Validation, Visualization, Writing – Review & Editing; MH: Resources, Data curation, Formal analysis, Software, Investigation, Validation, Visualization; MRZ: Resources, Data curation, Formal analysis, Software, Investigation, Validation, Visualization; BMA: Resources, Methodology, Data curation, Software, Investigation, Validation, Visualization; HAA: Resources, Methodology, Data curation, Formal analysis, Software, Investigation, Validation, Visualization, Writing–original draft.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

References

1. Costa HE, Cairrao E. Effect of bisphenol A on the neurological system: a review update. Arch Toxicol 2024;98(1):1–73. https://doi.org/10.1007/s00204-023-03614-0.
2. Zulkifli S, Rahman AA, Kadir SHSA, Nor NSM. Bisphenol A and its effects on the systemic organs of children. Eur J Pediatr 2021;180(10):3111–3127. https://doi.org/10.1007/s00431-021-04085-0.
3. Khan NG, Tungekar B, Adiga D, Chakrabarty S, Rai PS, Kabekkodu SP. Alterations induced by Bisphenol A on cellular organelles and potential relevance on human health. Biochim Biophys Acta Mol Cell Res 2023;1870(7):119505. https://doi.org/10.1016/j.bbamcr.2023.119505.
4. Wang K, Zhao Z, Ji W. Bisphenol A induces apoptosis, oxidative stress and inflammatory response in colon and liver of mice in a mitochondria-dependent manner. Biomed Pharmacother 2019;117:109182. https://doi.org/10.1016/j.biopha.2019.109182.
5. Tummers B, Green DR. The evolution of regulated cell death pathways in animals and their evasion by pathogens. Physiol Rev 2022;102(1):411–454. https://doi.org/10.1152/physrev.00002.2021.
6. Chen S, Lv X, Hu B, Shao S, Wang B, Ma K, et al. RIPK1/RIPK3/MLKL-mediated necroptosis contributes to compression-induced rat nucleus pulposus cells death. Apoptosis 2017;22(5):626–638. https://doi.org/10.1007/s10495-017-1358-2.
7. Dhuriya YK, Sharma D. Necroptosis: a regulated inflammatory mode of cell death. J Neuroinflammation 2018;15(1):199. https://doi.org/10.1186/s12974-018-1235-0.
8. Ambati RR, Phang SM, Ravi S, Aswathanarayana RG. Astaxanthin: sources, extraction, stability, biological activities and its commercial applications-a review. Mar Drugs 2014;12(1):128–152. https://doi.org/10.3390/md12010128.
9. Ibrahim KA, Abdelgaid HA, Eleyan M, Khwanes SA, Abdel-Daim MM. Ethoprophos induces rats' brain injury and neurobehavioral impairment via transcriptional activation of glial fibrillary acidic protein and tubulin-associated unit even at the threshold inhibition of acetylcholinesterase: A 90-days study. Sci Total Environ 2021;777:146216. https://doi.org/10.1016/j.scitotenv.2021.146216.
10. Dang Y, Li Z, Yu F. Recent advances in astaxanthin as an antioxidant in food applications. Antioxidants (Basel) 2024;13(7):879. https://doi.org/10.3390/antiox13070879.
11. Nishida Y, Berg PC, Shakersain B, Hecht K, Takikawa A, Tao R, et al. Astaxanthin: past, present, and future. Mar Drugs 2023;21(10):514. https://doi.org/10.3390/md21100514.
12. Zhang XS, Zhang X, Zhou ML, Zhou XM, Li N, Li W, et al. Amelioration of oxidative stress and protection against early brain injury by astaxanthin after experimental subarachnoid hemorrhage. J Neurosurg 2014;121(1):42–54. https://doi.org/10.3171/2014.2.JNS13730.
13. Faheem NM, El Askary A, Gharib AF. Lycopene attenuates bisphenol A-induced lung injury in adult albino rats: a histological and biochemical study. Environ Sci Pollut Res Int 2021;28(35):49139–49152. https://doi.org/10.1007/s11356-021-14140-w.
14. Contó MB, de Carvalho JGB, Benedito MAC. Behavioral differences between subgroups of rats with high and low threshold to clonic convulsions induced by DMCM, a benzodiazepine inverse agonist. Pharmacol Biochem Behav 2005;82(3):417–426. https://doi.org/10.1016/j.pbb.2005.09.012.
15. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248–254. https://doi.org/10.1016/0003-2697(76)90527-3.
16. Feather-Stone RM. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol 1961;7:88–95. https://doi.org/10.1016/0006-2952(61)90145-9.
17. Garcia YJ, Rodríguez-Malaver AJ, Peñaloza N. Lipid peroxidation measurement by thiobarbituric acid assay in rat cerebellar slices. J Neurosci Methods 2005;144(1):127–135. https://doi.org/10.1016/j.jneumeth.2004.10.018.
18. Ellman GL. Tissue sulfhydryl groups. Arch Biochem Biophys 1959;82(1):70–77. https://doi.org/10.1016/0003-9861(59)90090-6.
19. Habig WH, Pabst MJ, Jakoby WB. Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J Biol Chem 1974;249(22):7130–7139.
20. Marklund S, Marklund G. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 1974;47(3):469–474. https://doi.org/10.1111/j.1432-1033.1974.tb03714.x.
21. Aebi H. Catalase in vitro. Methods Enzymol 1984;105:121–126. https://doi.org/10.1016/s0076-6879(84)05016-3.
22. Horobin RW. Theory of histological staining: why and how staining happens. In: Suvarna K, Layton C, Bancroft J, editors. Bancroft’s theory and practice of histological techniques. Elsevier; 2018. 114–125.
23. Kim SW, Roh J, Park CS. Immunohistochemistry for pathologists: protocols, pitfalls, and tips. J Pathol Transl Med 2016;50(6):411–418. https://doi.org/10.4132/jptm.2016.08.08.
24. Yuan JS, Reed A, Chen F, Stewart CN Jr. Statistical analysis of real-time PCR data. BMC Bioinformatics 2006;7:85. https://doi.org/10.1186/1471-2105-7-85.
25. Al-Shami AS, Abd Elkader HTAE, Moussa N, Essawy AE, Haroun M. Early-life bisphenol A exposure causes neuronal pyroptosis in juvenile and adult male rats through the NF-κB/IL-1β/NLRP3/caspase-1 signaling pathway: exploration of age and dose as effective covariates using an in vivo and in silico modeling approach. Mol Cell Biochem 2025;480(4):2301–2330. https://doi.org/10.1007/s11010-024-05039-4.
26. Eleyan M, Zughbur MR, Hussien M, Ayesh BM, Ibrahim KA. Carvacrol modulates antioxidant enzymes, DNA integrity, and apoptotic markers in zearalenone-exposed fetal rat liver. Drug Chem Toxicol 2025;48(3):547–556. https://doi.org/10.1080/01480545.2024.2425984.
27. Morsy MM, Ahmad MM, Hassan NH. Maternal exposure to low-dose bisphenol A and its potential neurotoxic impact on male pups: A histological, immunohistochemical, and ultrastructural study. Tissue Cell 2024;90:102503. https://doi.org/10.1016/j.tice.2024.102503.
28. Zhang Y, Pei X, Jing L, Qingyu Zhang Q, Zhao H. Lead induced cerebellar toxicology of developmental Japanese quail (Coturnix japonica) via oxidative stress-based Nrf2/Keap1 pathway inhibition and glutathione-mediated apoptosis signaling activation. Environ Pollut 2024;352:124114. https://doi.org/10.1016/j.envpol.2024.124114.
29. Ibrahim KA, Eleyan M, Khwanes SA, Mohamed RA, Ayesh BM. Alpha-mangostin attenuates the apoptotic pathway of abamectin in the fetal rats' brain by targeting pro-oxidant stimulus, catecholaminergic neurotransmitters, and transcriptional regulation of reelin and nestin. Drug Chem Toxicol 2022;45(6):2496–2508. https://doi.org/10.1080/01480545.2021.1960856.
30. Gasiorowska A, Wydrych M, Drapich P, Zadrozny M, Steczkowska M, Niewiadomski W, et al. The biology and pathobiology of glutamatergic, cholinergic, and dopaminergic signaling in the aging brain. Front Aging Neurosci 2021;13:654931. https://doi.org/10.3389/fnagi.2021.654931.
31. Abd Elkader HTAE, Abdou HM, Khamiss OA, Essawy AE. Anti-anxiety and antidepressant-like effects of astragaloside IV and saponins extracted from Astragalus spinosus against the bisphenol A-induced motor and cognitive impairments in a postnatal rat model of schizophrenia. Environ Sci Pollut Res Int 2021;28(26):35171–35187. https://doi.org/10.1007/s11356-021-12927-5.
32. Monzani E, Nicolis S, Dell’Acqua S, Capucciati A, Bacchella C, Zucca FA, et al. Dopamine, oxidative stress and protein-quinone modifications in Parkinson's and other neurodegenerative diseases. Angew Chem Int Ed Engl 2019;58(20):6512–6527. https://doi.org/10.1002/anie.201811122.
33. Oliyaei N, Moosavi-Nasab M, Tanideh N, Iraji A. Multiple roles of fucoxanthin and astaxanthin against Alzheimer's disease: Their pharmacological potential and therapeutic insights. Brain Res Bull 2023;193:11–21. https://doi.org/10.1016/j.brainresbull.2022.11.018.
34. Akinade TC, Babatunde OO, Adedara AO, Adeyemi OE, Otenaike TA, Ashaolu OP, et al. Protective capacity of carotenoid trans-astaxanthin in rotenone-induced toxicity in Drosophila melanogaster. Sci Rep 2022;12:4594. https://doi.org/10.1038/s41598-022-08409-4.
35. Al-Amin MM, Rahman MM, Khan FR, Zaman F, Reza HM. Astaxanthin improves behavioral disorder and oxidative stress in prenatal valproic acid-induced mice model of autism. Behav Brain Res 2015;286:112–121. https://doi.org/10.1016/j.bbr.2015.02.041.
36. Bakr AA, Ali M, Ibrahim K. Garlic and allopurinol alleviate the apoptotic pathway in rats' brain following exposure to fipronil insecticide. Environ Anal Health Toxicol 2022;37(4)e2022037. https://doi.org/10.5620/eaht.2022037.
37. Khan S, Beigh S, Chaudhari BP, Sharma S, Abdi SAH, Ahmadet S. Mitochondrial dysfunction induced by Bisphenol A is a factor of its hepatotoxicity in rats. Environ Toxicol 2016;31(12):1922–1934. https://doi.org/10.1002/tox.22193.
38. Othman AI, Edrees GM, El-Missiry MA, Ali DA, Aboel-Nour M, Dabdoub BR. Melatonin controlled apoptosis and protected the testes and sperm quality against bisphenol A-induced oxidative toxicity. Toxicol Ind Health 2016;32(9):1537–1549. https://doi.org/10.1177/0748233714561286.
39. Eleyan M, Ibrahim KA, Mohamed RA, Hussien M, Zughbur MR, Aldalou AR, et al. Quercetin diminishes the apoptotic pathway of magnetite nanoparticles in rats' ovary: Antioxidant status and hormonal profiles. Environ Anal Health Toxicol 2024;39(3)e2024025. https://doi.org/10.5620/eaht.2024025.
40. Chelikani P, Fita I, Loewen PC. Diversity of structures and properties among catalases. Cell Mol Life Sci 2004;61(2):192–208. https://doi.org/10.1007/s00018-003-3206-5.
41. Brotosudarmo THP, Limantara L, Setiyono E. Structures of astaxanthin and their consequences for therapeutic application. Int J Food Sci 2020;2020:2156582. https://doi.org/10.1155/2020/2156582.
42. Márquez-Valadez B, Maldonado PD, Galván-Arzate S, Méndez-Cuesta LA, La Cruz VPD, Pedraza-Chaverrí J, et al. Alpha-mangostin induces changes in glutathione levels associated with glutathione peroxidase activity in rat brain synaptosomes. Nutr Neurosci 2012;15(5):13–19. https://doi.org/10.1179/147683012X13327575416400.
43. Jo C, Gundemir S, Pritchard S, Jin YN, Rahman I, Johnson GVW. Nrf2 reduces levels of phosphorylated tau protein by inducing autophagy adaptor protein NDP52. Nat Commun 2014;5:3496. https://doi.org/10.1038/ncomms4496.
44. Song JH, Hwang B, Kim SB, Choi YH, Kim WJ, Moon SK. Bisphenol A modulates proliferation, apoptosis, and wound healing process of normal prostate cells: Involvement of G2/M-phase cell cycle arrest, MAPK signaling, and transcription factor-mediated MMP regulation. Ecotoxicol Environ Saf 2023;249:114358. https://doi.org/10.1016/j.ecoenv.2022.114358.
45. Liu L, Liu X, Zhao L, Liu Y. 1,8-cineole alleviates bisphenol A-induced apoptosis and necroptosis in bursa of Fabricius in chicken through regulating oxidative stress and PI3K/AKT pathway. Ecotoxicol Environ Saf 2021;226:112877. https://doi.org/10.1016/j.ecoenv.2021.112877.
46. Reventun P, Sanchez-Esteban S, Cook A, Cuadrado I, Roza C, Moreno-Gomez-Toledano R, et al. Bisphenol A induces coronary endothelial cell necroptosis by activating RIP3/CamKII dependent pathway. Sci Rep 2020;10:4190. https://doi.org/10.1038/s41598-020-61014-1.
47. Bahbah EI, Ghozy S, Attia MS, Negida A, Emran TB, Mitra S, et al. Molecular mechanisms of astaxanthin as a potential neurotherapeutic agent. Mar Drugs 2021;19(4):201. https://doi.org/10.3390/md19040201.
48. Kim SS, Hwang KS, Yang JY, Chae JS, Kim GR, Kan H, et al. Neurochemical and behavioral analysis by acute exposure to bisphenol A in zebrafish larvae model. Chemosphere 2020;239:124751. https://doi.org/10.1016/j.chemosphere.2019.124751.

Article information Continued

Figure 1.

Alleviation efficiency of ASX against BPA-induced histopathological changes in the brain tissue. (A) Control group, (B) ASX group, (C) BPA group, and (D) ASX/BPA group.

Figure 2.

Alleviation efficiency of ASX against BPA-induced alterations in the brain transcript levels of p53 (A), Bcl2 (B), caspase-9 (C), FADD (D), RIKP1 (E), RIKP3 (F), and MLKL (G) in male rats. Each value represents the mean ± SEM. Means with different letters indicated the variations between the groups within the same column using Tukey’s honestly significant difference (p < 0.05) test.

Figure 3.

Photomicrographs of brain sections stained for Bax protein expression using an immunohistochemical technique. Control group (A), ASX group (B), BPA group (C), and ASX/BPA group (D). Each value of the immune area represents the mean ± SEM. Means with different letters indicated the variations between the groups within the same column using Tukey’s honestly significant difference (p < 0.05) test (E).

Figure 4.

Figure Photomicrographs of brain sections stained for caspase-3 protein expression using an immunohistochemical technique. Control group (A), ASX group (B), BPA group (C), and ASX/BPA group (D). Each value of the immune area represents the mean ± SEM. Means with different letters indicated the variations between the groups within the same column using Tukey’s honestly significant difference (p < 0.05) test (E).

Figure 5.

Graphic abstract of BPA-induced apoptosis, necroptosis and neurobehavioral deficient of brain of mature rats and the protective effect of ASX: it is proposed that BPA pass the cell membrane increase the ROS formation and cause lipid peroxidation (MDA) [36] this cause oxidative damage, depleting cellular antioxidants (GSH, GST, SOD &CAT), inhibition of AchE enzyme, increasing levels of neurotransmitters (dopamine, serotonin and norepinephrine) that responsible for anxiety behaviors [32]. ROS also cause DNA damage that activates p53 that declines anti-apoptotic Bcl-2 and enhances BAX that activate mitochondria to release cytochrome c then caspase-9 is activated that activates caspase-3 and then apoptosis process [44]. On the other hand, BPA induced increase of inflammatory cytokines that activates death receptors, activating RIPK1, RIPK3 and MLKL that activating programmed necrosis (necroptosis) [38]. Beside this RIPK1 extrinsic apoptosis pathway by activating FADD that in turn activates caspase cascade till caspase-3. ASX reverting this process by decreasing oxidative stress and inflammation [48].

Table 1.

Primer sequences used in SYBR Green RT-PCR.

Gene Primer Sequence (5'-3') Product Length Accession Number Tm (°C)
Caspase-9 F- CTGGCCCAGTGTGAATACCT 233 NM_001429871.1 55
R- CTCAGTCAACTCCTGGGCTC
Bcl-2 F-ATCGTCGCCTTCTTCGAGTT 150 NM_016993.2 60
R-ATCCCATCCTCCGTTGTCCT
p53 F-GTCGGCTCCGACTATACCACTATC 247 NM_001429996.1 61
R-CTCTCTTTGCACTCCCTGGGGG
RIPK-3 F-TAGTTTATGAAATGCTGGACCGC 145 XM_039092983.2 59
R-GCCAAGGTGTCAGATGATGTCC
RIPK-1 F-AGGTACAGGAGTTTGGTATGGGC 123 XM_063276410.1 61
R-GGTGGTGCCAAGGAGATGTATG
ß-actin F- TCCTCCTGAGCGCAAGTACTCT 153 NM_031144.3 63
R- GCTCAGTAACAGTCCGCCTAGAA

Table 2.

The impact of ASX on behavioral responses of the BPA-exposed rats.

Control ASX BPA ASX/BPA F-value
Rearing 12.31 ± 1.31a 11.56 ± 1.37 a 27.3 ± 2.2b 18.5 ± 1.6c 19.3
Grooming 2.1 ± 0.54a 2.38 ± 0.71a 7.47 ± 1.01b 3.93 ± 1.08a 8.1
Time spent in the central arena 4.09 ± 0.94a 5.12 ± 1.12a 11.91 ± 2.1b 8.32 ± 1.6a 5.4
Defecation 3.88 ± 0.63a 4.07 ± 0.6a 5.8 ± 0.7a 4.5 ± 0.69a 1.7

Each value represents the mean ± SE. Means with different letters indicated the variations between the groups within the same column using Turkey's honestly significant difference (p < 0.05) test.

Table 3.

The impact of ASX brain neurochemical parameters of the BPA-exposed rats

Control ASX BPA ASX/BPA F-value
Dopamine (ng/g tissue) 191.5 ± 10.9a 185.2 ± 13.1a 324.1 ± 6.2b 232.9 ± 7.8c 42.1
Norepinephrine (ng/g tissue) 153.46 ± 7.9a 156.2 ± 6.2a 276.5 ± 8.1b 211.8 ± 20.6c 22.7
Serotonin (ng/g tissue) 186.43 ± 5.4a 183.9 ± 6.3a 321.1 ±8.4b 267.4 ± 17.9c 38.2
AChE (μM/min/mg protein) 211.5 ± 4.8a 209.3 ± 7.8a 136.24 ± 9.5b 170.7 ±7.3c 22.4

Each value represents the mean ± SE. Means with different letters indicated the variations between the groups within the same column using Turkey's honestly significant difference (p < 0.05) test.

Table 4.

Protective effects of ASX against the BPA-induced variations in the rats brain oxidative/antioxidative parameters.

Control ASX BPA ASX/BPA F-value
MDA (nmol/g tissue) 17.32 ± 1.5a 16.01 ± 1.27a 36.1 ±1.14b 25.98 ±1.7c 42.6
GSH (mg/g tissue) 26.42 ± 1.7a 28.2 ± 1.26a 15.67 ±0.65b 19.52 ±0.9c 19.1
GST (μM/min/mg protein) 148.01 ± 3.6a 153.2 ± 4.6a 81.5 ± 3.72b 110.3 ± 2.2c 83.8
SOD (μM/min/mg protein) 18.38 ± 1.7a 21.28 ± 1.7a 7.59 ±0.66b 10.51 ±0.6a 25.4
CAT (μM/min/mg protein) 13.5 ± 1.7a 14.6 ± 2.53a 5.91 ± 0.9b 10.9 ± 1.9a 4.2

Each value represents the mean ± SE. Means with different letters indicated the variations between the groups within the same column using Turkey's honestly significant difference (p < 0.05) test.