| Home | E-Submission | Sitemap | Contact Us |  
Environ Anal Health Toxicol > Volume 39:2024 > Article
Subebe, Ogaro, Dayon, Manting, Murashima, Omori, Guihawan, Uy, Mazahery, and Villacorte-Tabelin: Phytochemical evaluation, embryotoxic, and teratogenic effects of Buwakan (Decalobanthus peltatus (L.) A.R.Simões & Staples) leaf extracts on duck embryo


Decalobanthus peltatus is a woody vine that is commonly utilized in traditional Southeast Asian medicinal preparations. Despite the documented therapeutic uses of D. peltatus, there is hardly any information regarding its toxic effects on its consumers. In this study, crude leaf extracts (aqueous, methanol, ethyl acetate, and hexane) from D. peltatus were prepared and evaluated for their embryotoxicity and teratogenic effects. Phytochemical screening of bioactive compounds from the plants showed the presence of alkaloids, flavonoids, saponins, steroids, and tannins. In addition, investigations on the toxicity of the crude leaf extracts were determined using brine shrimp lethality assay, in which the LC50 was calculated. Results showed that the ethyl acetate leaf extract was the most toxic among the crude leaf extracts, with an LC50 of 14.54 ppm. Based on this result, ethyl acetate leaf extract was treated on duck embryos, and the alteration of vascular branching patterns in the chorioallantoic membrane was quantified. Gross morphological and histological analysis of the skin tissues from the treated duck embryos were also examined. We found significant reduction of primary and tertiary vessel diameters in the duck embryos treated with ethyl acetate leaf extracts in both concentrations compared to the control group. Treated duck embryos exhibited gross malformations, growth retardation, and hemorrhages on the external body surfaces at 1000 ppm. Histopathological analysis of the skin tissues from the 14-day-old treated duck embryos showed a reduced number of feather follicles compared to the control group. These results suggest that D. peltatus crude leaf extracts present risks when taken in significant dosages and comprehensive toxicity testing on therapeutic herbs should be performed to ensure their safety on the consumers.


Plants are a rich source of bioactive metabolites and phytochemicals, which are used for their medicinal and therapeutic characteristics [1]. Due to this characteristic, humans have been using plant parts to treat various diseases since time immemorial and are considered an alternative healthcare medicine for approximately 85% of the world's population [2,3]. Plants with medicinal properties commonly contain bioactive compounds such as tannins, saponins, flavonoids, alkaloids, steroids, and other derivatives [4,5,6]. Nowadays, these bioactive compounds are studied thoroughly to determine their physiological, behavioral, and immunological effects, which can be beneficial to humans.
Despite the use of medicinal plants to treat various diseases, there is still a lack of valid experimental evidence for their adverse effects [7]. Depending on their origin and nature, medicinal plants can be a source of toxic element exposure. For instance, preparation and use of medicinal plants can cause damage to human health [8]. Numerous studies have already been conducted to investigate the toxicity of medicinal plants on human organs such as the kidneys, heart, liver, and skin [9,10,11]. Studies have found that certain plants contain toxic elements such as arsenic, which causes skin pigmentation, skin cancer, and hyperkeratosis in feet and hands [12,8,6]. Plant extract toxicity can also be fatal due to poisoning manifested as vomiting, lightheadedness, and heart block [13]. Olayode et al., [14] showed that the repeated treatment of leaf extract of Stachytarpheta cayennensis (blue snakeweed) to male and female rats led to hemorrhage, pyknotic nuclei, vascular congestion, tissue necrosis, and disruption of hepatocytes (liver) arrangement. In addition, Chebaibi et al., [15] also showed that the use of plants traditionally used in the treatment of edema and renal colic is toxic to organs of the body, such as the liver. Aside from that, insufficient research on herbal medicines with uncertain pharmacologic action poses a danger to developing fetuses [16,17]. The most documented adverse effects of medicinal treatments during pregnancy include uterine contraction stimulation and abortion [18]. Various traditional medicines have ingredients that can cross the placenta and reach and impact the fetus, and certain natural medicines have been documented to cause pregnancy loss due to hormone imbalance that could end in abortion [19,20]. With these reports, the World Health Organization (WHO) emphasized the safety of herbal medicines by issuing guidelines for herbal medicine assessment and emphasizing the importance of toxicity studies [7].
One of the commonly used medicinal plants from the Philippines is Decalobanthus peltatus, locally called Buwakan, from the Convolvulaceae family in the Philippines. It is a coarse, woody vine with alternate, smooth, and somewhat rounded leaves [21]. Extracts from these plants are used to treat diarrhea, cough, abdominal pain, sore eyes, and wound inflammation and aid during childbirth [22]. Studies have shown that it has antioxidant and alpha-glucosidase inhibitor activities, which can be helpful in diabetic treatment [23]. This plant is also reported to contain bioactive compounds with broad antimicrobial activity [21]. Despite the usefulness of this plant extract, there are limited reports regarding the embryotoxicity and teratogenic effects of D. peltatus extracts. To address this need, this study investigated the embryotoxic and teratogenic effects of D. peltatus crude leaf extracts on duck embryos [24, 25, 26]. Cost-efficient extraction of plant materials was achieved by employing the maceration technique with methanol as the initial extraction solvent, followed by subsequent liquid-liquid extraction with water, n-hexane, and ethyl acetate [27, 28]. To the best of our knowledge, this will be the first report in the Philippines evaluating the toxic effects of D. peltatus in animal models.

Materials and Methods

Study area

The plant samples were collected from the municipality of Cagdianao, Dinagat Islands (Fig. 1), where it is used as medicine such as wound healing by the local inhabitants. A gratuitous permit was provided by the Department of Natural Resources, allowing the researcher to collect samples from Dinagat Island, Philippines.

Morphological and molecular identification of the plant

The plant samples were identified and confirmed by a Botanist from the Department of Biological Sciences, College of Science and Mathematics, MSU-Iligan Institute of Technology, Iligan City, Philippines. Voucher specimens (USTH 017-729) were deposited at the University of Santo Tomas Herbarium.
To further confirm species identification, DNA extraction was performed in the Developmental Biology laboratory, PRISM, MSU-IIT, Iligan City, Philippines, and was done following the protocol provided in the DNA extraction kit (Invitrogen Life Technologies, USA).
The PCR amplification, purification, bidirectional DNA sequencing, and analysis of the DNA extracted from the sample were performed in Macrogen Incorporation (Seoul, South Korea). PCR amplification and DNA sequencing were carried out as per the protocol developed by the manufacturer. The primers used are the forward primer: ITS3- 5’GCATCGATGAAGAACGCAGC3’ and Reverse primer: ITS4- 3’TCCTCCGCTTCTTGATATGC5’, targeting the internal transcribed spacer 2 (ITS2) region of the ITS sequence.

Methanolic Crude Extract Preparation

The plant pieces were air-dried in the shade for two to three weeks until all moisture had been eliminated. The dried leaves were finely macerated and then immersed in 100% absolute methanol at a 1 g : 4 mL ratio. For three days, the soaked plant pieces were stored in a dark spot. Then, the extracts were filtered using a Whatman no.1 filter paper. A rotary evaporator (Rotavapor® R-100, Buchi, Switzerland) was used to remove the extraction solvent and get the concentrated plant extracts [29, 30, 31]. Serial dilution for the crude extract was then performed.

Preliminary Phytochemical Screening

The crude extract of D. peltatus was subjected to preliminary phytochemical screening performed by a Registered Chemist from the Department of Chemistry of the Mindanao State University- Iligan Institute of Technology using standard methods [ 32, 33] with modifications.

Test for Alkaloid

2 mg of the crude extract from the prepared stock solution was added to 2 mL of 2 M of HCl. The filtrates were then treated with 1 mL of potassium bismuth iodide solution (Dragendorff's reagent). The formation of an orange precipitate determined the presence of an alkaloid.

Test for Flavonoids

A few drops of 1.0 M sodium hydroxide solution were added to 2 mg of the crude extract. The appearance of a strong yellow color that turns colorless upon the addition of HCl indicates the presence of flavonoids.

Test for Saponins

About 5 mg of plant extract was mixed with 5 mL of distilled water. The solution was shaken vigorously. Persistent frothing indicates the presence of saponin in the extract.

Test for Steroids

2 mg of the plant extract was dissolved with 2 mL of chloroform. An equal volume of concentrated sulfuric acid was added from the side of the test tube. The presence of steroids was detected by the formation of a violet-to-blue-colored ring at the confluence of the two liquids.

Test for Tannins

About 0.5 g of crude extract was mixed in 10 mL of distilled water. The solution was filtered, and 2 mL of 5 % ferric chloride was added to the filtrate. The discoloration of the solution to brownish-green or blue-black color indicates the presence of tannins.

Preparation of Water, Hexane, and Ethyl Acetate Extract

After rotary evaporation, the concentrated plant extract was subjected to solvent partitioning. Three distinct solvents with various polarity indices were used for solvent-solvent partitioning: 100% hexane (0 polarities), 100 % ethyl acetate (4.4 polarities), and water (9 polarities). The partitioning was done in stages based on rising polarity [31].

Water and Hexane Partition

Partitioning was performed using the method described by the group of Abu (2017) with minor adjustments. One g of crude methanolic extract was dissolved in 20 ml of distilled water, then 20 ml of 100 % hexane was added. The hexane layers were filtered and concentrated under a vacuum in a rotary evaporator.

Water and Ethyl Acetate Partition

The hexane extract was partitioned further with ethyl acetate. The densities of the solvents determined the identities of the layers. The collected ethyl acetate layer was concentrated under vacuum in a rotary evaporator, and the water layer was freeze-dried and carefully packed in a container with parafilm. These samples were kept at 20 °C for the succeeding experiments.

Brine Shrimp Lethality Assay

Brine Shrimp Lethality Assay (BSLA) from an existing protocol with minor modifications [34, 35]. Five (5) g of brine shrimp eggs were placed in a brine incubator and immersed in 500 mL of synthetic seawater, with light and aeration, for 48 hours. The cytotoxicity test was carried out by weighing 50 mg of the extract, which was dissolved in 1 % of Dimethyl sulfoxide (DMSO) pipetted into concentrations of 1000 ppm, 500 ppm, 250 ppm, 125 ppm, 62.5 ppm inserted into vials. Three replicates were made for every concentration. Five mL of artificial seawater was added and homogenized with a vortex. Each vial contained ten brine shrimp larvae and 50 μL of a yeast solution as feeding. The vials were placed under the heat lamp and left for 24 hours. The LC50 value was calculated using the probit analysis of the Statistical Package for the Social Sciences (SPSS) application 26th Version. An LC50 value <1000 ppm is considered active.

Preparation of test organism

Fertile duck eggs (embryonic day 1) were acquired from a local vendor in Iligan City, Philippines. Dirt, excrement, and debris were removed from the eggshells and were placed in an aseptic egg incubator for a day for acclimatization. The candling method was conducted to check the viability of the eggs to be used and to check the location of the air sac and mark it. Eggs with underdeveloped and dead embryos were discarded.

Treatment of D. peltatus leaf extract on duck embryo

The desired concentration was obtained by dissolving 100 mg of crude extract into 10 ml of 1% DMSO and 100 mg of freeze-dried crude extract into distilled water as stock solution. The stock solution was serially diluted into five appropriate concentrations based on the result from the BSLA assay. For each concentration, 30 eggs were utilized, 10 for each day of observation (days 7, 14, and 21). Prior to treatment, the eggs were gently wiped with 70% ethanol once. A small hole was made around the air sac. The eggs were treated on day 3 of incubation. Then, the eggs were re-treated daily following the first treatment until the day of observation [36,37]. The treatments were injected through the hole using a sterile syringe. The holes were resealed with parafilm, and the treated eggs were incubated until observation. The process was done in a laminar flow hood to avoid contamination. This study employed a Completely Randomized Design (CRD), ensuring that all test solutions (D. peltatus leaf extract) and negative control were tested on duck embryos.

Analysis of the effects of D. peltatus leaf extract on vasculogenesis and angiogenesis

On day 7 of incubation, live embryos were selected for observation [38]. A 3x2 cm window was made on top of the embryo to view the vascular region or the chorioallantoic membrane (CAM) of the embryo. The vascular region was photographed and analyzed using an image analyzer software, ImageJ [39]. A specific region was extracted from the captured images. The extracted region was the right-lateral vitelline vascular plexus, measuring around 159 mm2 and containing 1100x1800 pixels [36]. The photos were converted to 8-bit format and treated to improve edge recognition in preparation for the next steps. Finally, their color levels were reduced to binarized (black and white) format, and the images were skeletonized. The skeletonized image depicts the object’s structural form. For each treatment and control group, ten (10) images were processed. The effects of D. peltatus on early embryonic vasculogenesis and angiogenesis were determined using the number of junctions, average branch length, vascular density, and vascular length density quantification.

Gross evaluation and measurement of the embryo

The embryos were examined at different time intervals of days 7, 14, and 21 of incubation [36]. At each time point, the eggs were opened, and the embryos were removed to examine any gross injuries or abnormalities on the body. The body weight was measured using a digital weighing scale. The average weight of the embryos was computed. At the end of each observation, all embryos were humanely killed by rapid cooling [40, 41].

Histopathological evaluation

Skin tissues from the duck embryos at days 7, 14, and 21 were dissected and placed in 10% neutral buffered formalin. Paraffin-embedded tissues were cut using a microtome at 6 μm thickness (HistoCore BIOCUT, Leica Biosystems). Serial sections were stained with H&E for investigation under a light microscope (Olympus CX22LED) [42,43].

Data analysis

All the graphs and statistical analyses were performed using GraphPad Prism software version 9.0 for Windows (GraphPad Software, San Diego, CA, USA). One-way analysis of variance (ANOVA) was conducted, followed by Tukey’s test to determine the significant difference between the ImageJ parameters among the embryos. Dunnett’s multiple comparisons test was used for diameter measurements of primary, secondary, and tertiary vessels. Two-way analysis of variance (ANOVA) followed by Tukey’s test was used to analyze the significant differences in the embryo weight of the experimental and control groups. A p-value of <0.05 was defined as statistically significant.

Results and Discussion

Phytochemical Screening of the crude extract of Decalobanthus peltatus

The phytochemical screening result yielded several bioactive compounds that include the presence of alkaloids, flavonoids, saponins, steroids, and tannins. Detected bioactive compounds are visualized by certain levels of abundance, where a + sign corresponds to the positive presence of the active compound, wherein a single, double, and triple + sign suggests the degree of detection in increasing order.
Table 1 enumerates the bioactive compounds found in the plant extracts and their level of detection. It shows the presence of alkaloids, flavonoids, saponins, steroids, and tannins.
The presence of these secondary metabolites in the leaf extract is significant as they may contribute to the traditional use of this plant to treat various ailments. Among these compounds, flavonoids, saponins, and tannins were abundant in D. peltatus. Substantial research into the health effects of flavonoids and their modes of action has gained the public's attention. Flavonoids are generally referred to as antioxidants since they are polyphenolic and may absorb free radicals [44]. While this feature may be valuable in food shelf-life research, it is exceedingly improbable that the health advantages of flavonoids are related to direct-acting antioxidant activity [45]. Saponins have several biological functions, including antibacterial, antifungal, antiviral, anti-inflammatory, anti-ulcer, hemolytic, and hepatoprotective effects [46, 47]. In addition, the saponins revealed the ability to operate synergistically with antibiotics, assisting in the recycling of old medications that were previously believed ineffective owing to resistance issues [48,49]. Tannins are the primary study topic in the development of natural alternatives to in-feed antibiotics due to their variety of biological functions such as antibacterial, anti-parasitic, antiviral, antioxidant, anti-inflammatory, and immunomodulation, among many others [50].

Brine Shrimp Lethality Test of the Different Crude Leaf Extracts

Initial investigations of the D. peltatus crude leaf extracts were done using the Brine Shrimp Lethality Test. This test provides results about the %mortality of Artemia salina exposed to five different concentrations of each crude plant extract (aqueous, methanolic, hexane, and ethyl acetate) from D. peltatus. The %mortality values were then transformed using the Probit Table, and the regression analysis was done with the log value of the concentrations to get their LC50 values (Fig. 1). The LC50 values are classified according to Clarkson’s Toxicity Criteria with LC50 value greater than 1000 ppm as non-toxic, 500-1000 ppm LC50 value as low toxic, 100-499 ppm as medium toxic, and 0-99 ppm as highly toxic [51]. Results of the study show a trend in which the higher the concentration of the plant extracts, the higher the %mortality values. Among the crude leaf extracts, the ethyl acetate of the D. peltatus shows a high % mortality after 24 hours, followed by hexane extract. Aqueous and methanolic crude leaf extracts exhibit similar %mortality (Fig. 1).
Table 2 shows the LC50 values of the different plant extracts with their corresponding toxicity level. Ethyl acetate and hexane leaf extracts of D. peltatus display LC50 values of 14.54 ppm and 26.30 ppm, respectively, which, based on Clarkson’s Toxicity Criteria, is considered highly toxic. The methanolic and aqueous fractions are considered medium toxic. Based on these results, the ethyl acetate extract, being the most toxic among the crude leaf extracts, was utilized to determine its effect during angiogenesis and during the development of the duck embryos.
The primary goal of assessing the safety of any medicinal plant is to determine the nature and significance of any detrimental effect, as well as the exposure level at which this effect is detected [52, 53, 54, 55, 56]. While there is a substantial phylogenetic gap between brine shrimp (A. salina) and the duck embryo, the use of brine shrimp as a preliminary assay is justifiable if it is viewed as a screening tool that helps prioritize compounds for further, more specific toxicity testing on vertebrate target organism (e.g., avian embryos). Ritieni et al. [57], for instance, conducted research on the toxicity of fusaproliferin (FP) and two of its derivatives to A. salina and tested their teratogenic effects on fertilized chicken eggs. In addition, Hlywka et al. [58] who assessed the toxicity of mycotoxin fumonisin B1 (FB1), reported that although the chicken embryo bioassay requires a higher concentration of toxin, the FB1's toxicity was found to be comparable between the chicken embryo and brine shrimp bioassay at a cellular level. Thus, this approach balances the need for safety assessment with the ethical considerations and resource constraints associated with animal testing [59].
The current investigation found that the degree of lethality was directly related to extract concentration. After 24 hours of monitoring, the highest mortality was recorded at 1000 ppm concentrations and the lowest mortality at 62.5 ppm concentrations. It was discovered that at higher concentrations of treatment extracts, the shrimps began to die after the initial hours of treatment, and by 24 hours, nearly all the shrimps had died. The presence of terpenoids, steroids, flavonoids, saponins, and fonolic compounds could be accounted for their cytotoxic properties [21,22]. Overall, the fraction with the highest %mortality is the ethyl acetate fraction, implying that the bioactive compounds of interest are of similar polarity with ethyl acetate. Different solvents may result in extracts with varying concentrations of bioactive compounds due to the varying solubility of these compounds in different solvents [29]. These differences in extraction yield may lead to differences in the dose-response relationship observed in the bioassay. In this case, ethyl acetate as an extraction solvent may have favored the extraction of polar compounds in higher concentrations, which might have influenced its toxicity. The ethyl acetate extract of D. peltatus was found to be the most toxic among all the partitions because it yielded the lowest LC50. This result shows that it only took 14.54 ppm of D. peltatus ethyl acetate extract to kill 50 % of the brine shrimps. The rest of the extracts needed a higher concentration. To observe how the toxicity of ethyl acetate would manifest as a teratogen, ethyl acetate extract was used for the embryotoxicity test on duck embryos.

Vascular branching pattern analysis

To elucidate the effects of D. peltatus during angiogenesis, chorioallantoic membrane assay (CAM) was utilized, and the vascular branching pattern was quantified in treated duck embryos as compared to control groups.
The generating steps of the ImageJ parameters from the captured images are presented in Fig. 2. At the time of image acquisition (day 7 of incubation), the embryos were equivalent to Hamburger-Hamilton stage 28 [60]. In the control embryos, a rich network of vitelline circulation was observed surrounding the embryo (Fig. 2A). While in the treated groups, there was an observable thinning of the veins, especially those treated with 1000 ppm of the ethyl acetate leaf extract (Fig. 2B). The number of junctions of vessels, vascular density and vascular length density were decreased as compared with the controls but not statistically significant (Supplementary (Fig. 3A, B; 3C, D).
The CAM's vessel diameter distribution was found to be normal. However, the primary vessel diameters of the CAM treated with 1000 ppm and 500 ppm from the crude leaf extracts were significantly decreased than that of the control group (p<0.0001 and p<0.0372 respectively) (Fig. 4). It was also noted that the secondary and tertiary vessel diameters of the D. peltatus-treated groups were decreased compared to the control group but not statistically significant (Fig. 4).
The first indication of the toxicity of D. peltatus leaf extract in the duck embryos is the inhibition of early vascular development on the CAM. The number of junctions of the blood vessels of the embryo treated with the highest dose of D. peltatus showed to be lesser than that of the control, indicating that D. peltatus does have an inhibiting effect on the CAM vasculature. Embryos treated with 1000 ppm of D. peltatus showed the highest value of average branch length compared to the other groups. This result could indicate that the vasculature of the embryos treated with 1000 ppm of the extract contains long secondary branches and only a few tertiary vessels compared to the control and 500 ppm groups. The vascular density and vascular length density trends were almost identical. The ethyl acetate extract shows a reduction in vascularization in both measures. A comprehensive review by Olatunji et al. [61] on the genus Merremia, a homotypic synonym of Decalobanthus peltatus, shows that Merremia species have the potential to be developed into chemotherapeutic drugs since they demonstrated considerable cytotoxic effects and suppressed cancer cell growth. These results were attributed to different phytochemicals present in the species, including alkaloids, flavonoids, leucoanthocyanidins, steroids, and phenolics [21, 22, 61]. In addition to their ability to alter the activity of vital cellular enzymes, flavonoids are also crucial in medicine due to their anti-oxidative, anti-inflammatory, anti-mutagenic, and anti-carcinogenic properties [48]. Moreover, a studied alkaloid called sanguinarine from the roots of Sanguinaria canadensis has been reported to markedly suppress VEGF-induced endothelial cell migration and sprouting in vitro and blood vessel formation in vivo by blocking VEGF-induced Akt phosphorylation in a dose-dependent manner (10–300 nM) [62]. These bioactive compounds may also be involved in anti-vasculogenesis and anti-angiogenesis, which explain the reduction of the vascular plexus in injected embryos in the current investigation.

Gross morphological evaluation of the embryo

Gross morphological analysis of control and ethyl acetate leaf extract treated embryos during the first, second, and third trimesters of the growing period (days 7, 14, and 21 of the incubation periods, respectively) are shown in Figure 5. Embryos that are treated with both concentrations of D. peltatus showed no significant malformations in the first trimester (Fig. 5A, B, C). Gross evaluation of the embryos during the second trimester shows swelling and redness on the external body surfaces of both concentrations of the treated embryos compared to the control. The abnormalities are found mainly on the skin and appear as local or general hemorrhages (Fig. 5A, B, C). During the third trimester, more than half of the treated embryos show disorders characterized by moderate general redness and growth retardation (Fig. 5H, I). In comparison, all the control embryos and those that received a low extract concentration exhibited no gross disorder (Fig. 5A, D, and G).
The weight of the treated embryos at three different time points (days 7, 14, and 21 of the incubation period) are displayed in Figure 5J. The D. peltatus-treated embryos that received the 1000 ppm of D. peltatus were lighter as compared to the control (0.75 ± 0.02 g (95 % CI 0.70 ± 0.80), on day 7; 6.410 ± 0.25 g (95 % CI 5.86 ± 6.7), p =0.0010, on day 14; 16.88 ± 0.37g (95 % CI 16.04 ± 17.72), p < 0.0001, on day 21) (Fig. 5J). The embryos that received 500 ppm of plant extract showed a weight loss comparable to the control only at days 7 and 21 of the incubation period (0.78 ± 0.03 g (95 % CI 0.71 ± 0.85), p=0.0276 on day 7; 5.450 ± 0.13 g (95 % CI 5.15 ± 5.75), on day 14; 16.24 ± 0.61 g (95 % CI 14.86 ± 17.62), p < 0.0001on day 21) (Fig. 5J). The control embryos had average weight (0.66 ± 0.03 g (95 % CI 0.59 ± 0.73) on day 7; 4.92 ± 0.02 g (95 % CI 4.4 ± 5.4) on day 14; 22.66 ± 1.06 g (95 % CI 20.25 ± 25.07), and on day 21 (Fig. 5J).

Histopathological evaluation

Skin tissues from control and treated duck embryos at different time points were subjected to histopathological analysis (Fig. 6). The negative control group had normal skin layer morphology, including a thick intact epidermal layer with apparent dermis and with the presence of blood vessels (Fig. 6).
On day 14 of the incubation period (11 days after treatment with 1000 ppm of D. peltatus extract), histopathological analysis showed a reduced number of feather follicles as well as damage to the blood vessels (Fig. 6B). While at 500 ppm, the skin of the embryo shows no signs of damage to its epidermis and underlying dermis (Fig. 6C).
At day 21 of the incubation period (19 days after treatment with 1000 ppm), sloughing of the epidermis was observed in all the samples as compared to control (Fig. 6E). The structure of the skin included abnormal dermis and hypodermis morphology with significant thinning of the epidermal layer and larger blood vessels were observed in 500 ppm crude ethyl acetate leaf extract as compared to the control (Fig. 6F).
The severity of the gross and histopathological abnormalities was highest in the embryos treated with the highest extract concentration. The toxic effect on the skin may be due to some of the bioactive compounds present in the extract. Several Merremia species of the Convolvulaceae family are toxic to ruminants. De Brito et al., for example, observed spontaneous Merremia macrocalyx (Ruiz & Pav.) O'Donell poisoning in cattle in Pernambuco state, north-eastern Brazil [63]. Furthermore, Adebiyi and colleagues conducted an in-depth study assessing the acute and chronic toxicity of an ethanolic leaf extract obtained from Merremia tridentata (L.) Hallier f. using albino male rats as the experimental subjects. Their findings indicated that chronic exposure to the plant extract at a dose of 100 mg/kg did not result in any significant deviations in biochemical parameters compared to the control group. However, when higher doses of 200 and 400 mg/kg were administered, a substantial elevation in biochemical markers, including creatine, urea, transaminases, and creatine kinase, was observed. These outcomes suggest a potential for adverse effects on the kidney, liver, and heart [64]. Phytochemical investigations of D. peltatus revealed the presence of alkaloids [21]. A study conducted by Zhao et al. (2011) suggests that the intake of a type of alkaloid called pyrrolizidine alkaloid is responsible for skin cancer since it can lead to photosensitization in animals upon their consumption and metabolism [65]. Although the specific concentration of leaf extracts used by locals for pathological treatments is unknown, it is crucial to highlight these findings, which imply that D. peltatus leaf extract at high concentrations can cause skin toxicity.


This study presents the extraction of D. peltatus leaves using various solvents. Among these solvents, ethyl acetate exhibited the highest toxicity, as evidenced by the lowest LC50 value. Duck embryos treated with the highest concentration of D. peltatus extract displayed malformations, growth retardation, and hemorrhages on their external body surfaces. While the specific concentrations of leaf extracts used for traditional medicinal purposes remain uncertain, these findings underscore the potential for skin toxicity associated with high concentrations of D. peltatus leaf extract. Therefore, comprehensive toxicity assessments, including herbal toxicokinetics and high-throughput genetic sequencing, should be conducted to ensure the safety of therapeutic herbs on embryos.


The authors wish to thank the Department of Research of Mindanao State University-Iligan Institute of Technology SO#00148-2022 for financial support. We would also like to thank the Department of Science and Technology-Accelerated Science and Technology Human Resource Development Program (DOST-ASTHRDP) for the scholarship and financial support of MBS, JCO and MD.

Conflict of interest

All authors have declared no conflict of interest.


CRediT author statement
MJBS for conceptualization, investigation, formal analysis, wrote the original draft, revised, and edited the manuscript. JCO and MLD helped with investigation and formal analysis. MMEM verified the plant sample and resources. AM, AO, JQG, MMU and ARM helped with writing the original draft preparation, reviewing, and editing the manuscript. MVT for conceptualization, investigation, helped wrote the original draft, revised, edited the manuscript and funding acquisition


1. Alafiatayo AA, Lai KS, Syahida A, Mahmood M, Shaharuddin NA. Phytochemical evaluation, embryotoxicity, and teratogenic effects of Curcuma longa extract on zebrafish (Danio rerio). Evid Based Complement Alternat Med 2019;2019: 3807207 https://doi.org/10.1155/2019/3807207.
crossref pmid pmc
2. Pěsíc M. Development of natural product drugs in a sustainable manner. [cited Jul 11, 2023]. Available from: https://sustainabledevelopment.un.org/content/documents/6544118_Pesic_Development%20of%20natural%20product%20drugs%20in%20a%20%20sustainable%20manner.pdf.

3. Fitzgerald M, Heinrich M, Booker A. Medicinal plant analysis: a historical and regional discussion of emergent complex techniques. Front Pharmacol 2019;10: 1480 https://doi.org/10.3389/fphar.2019.01480.
crossref pmid pmc
4. Mujeeb F, Bajpai P, Pathak N. Phytochemical evaluation, antimicrobial activity, and determination of bioactive components from leaves of Aegle marmelos. Biomed Res Int 2014;2014: 497606 https://doi.org/10.1155/2014/497606.
crossref pmid pmc
5. Ali S, Khan MR, Sajid M, Zahra Z. Phytochemical investigation and antimicrobial appraisal of Parrotiopsis jacquemontiana (Decne) Rehder. BMC Complement Altern Med 2018;18: 43 https://doi.org/10.1186/s12906-018-2114-z.
crossref pmid pmc
6. Lobitaña IC, Virtudazo RME, Delfin AMP, Apura JNB, Picardal JP, Garces JJC. Embryotoxicity and teratogenicity of tamarind (Tamarindus indica L.) pulp extract using zebrafish (Danio rerio) embryo toxicity assay. Asian J Agric & Biol 2020;8(4):457-471 https://doi.org/10.35495/ajab.2020.02.139.
7. Subramanian K, Sankaramourthy D, Gunasekaran M. Toxicity studies related to medicinal plants. Natural Products and Drug Discovery: An Integrated Approach 2018;491-505 https://doi.org/10.1016/B978-0-08-102081-4.00018-6.
8. Brima EI. Toxic elements in different medicinal plants and the impact on human health. Int J Environ Res Public Health 2017;14(10):1209 https://doi.org/10.3390/ijerph14101209.
crossref pmid pmc
9. Nasri H, Shirzad H. Toxicity and safety of medicinal plants. Journal of HerbMed Pharmacology 2013;2(2):21-22.

10. Melchardt T, Magnes T, Weiss L, Grundbichler M, Strasser M, Hufnagl C, et al. Liver toxicity during temozolomide chemotherapy caused by Chinese herbs. BMC Complement Altern Med 2014;14: 115 https://doi.org/10.1186/1472-6882-14-115.
crossref pmid pmc
11. Shah NA, Khan MR, Nadhman A. Antileishmanial, toxicity, and phytochemical evaluation of medicinal plants collected from Pakistan. Biomed Res Int 2014;2014: 384204 https://doi.org/10.1155/2014/384204.
crossref pmid pmc
12. Shraim A, Cui X, Li S, Ng JC, Wang J, Jin Y, et al. Arsenic speciation in the urine and hair of individuals exposed to airborne arsenic through coal-burning in Guizhou, PR China. Toxicol Lett 2003;137(1-2):35-48 https://doi.org/10.1016/s0378-4274(02)00379-x.
crossref pmid
13. Khan I, Kant C, Sanwaria A, Meena L. Acute cardiac toxicity of Nerium oleander/indicum poisoning (Kaner) poisoning. Heart Views 2010;11(3):115-116 https://doi.org/10.4103/1995-705X.76803.
crossref pmid pmc
14. Chebaibi M, Bousta D, Chbani L, Ez zoubi Y, Touiti N, Achour S. Acute toxicity of plants mixture used in traditional treatment of edema and colic renal in Morocco. Scientific African 2019;6: e00152. https://doi.org/10.1016/j.sciaf.2019.e00152.
15. Olayode OA, Daniyan MO, Olayiwola G. Biochemical, hematological and histopathological evaluation of the toxicity potential of the leaf extract of Stachytarpheta cayennensis in rats. J Tradit Complement Med 2019;10(6):544-554 https://doi.org/10.1016/j.jtcme.2019.05.001.
crossref pmid pmc
16. Allaire A, Moos MK, Wells SR. Complementary and alternative medicine in pregnancy: a survey of North Carolina certified nurse-midwives. Obstet Gynecol 2000;95(1):19-23 https://doi.org/10.1016/s0029-7844(99)00481-0.
crossref pmid
17. Ahmed M, Hwang JH, Hasan MA, Han D. Herbal medicine use by pregnant women in Bangladesh: a cross-sectional study. BMC Complement Altern Med 2018;18(1):333 https://doi.org/10.1186/s12906-018-2399-y.
crossref pmid pmc
18. Bernstein N, Akram M, Yaniv-Bachrach Z, Daniyal M. Is it safe to consume traditional medicinal plants during pregnancy? Phytother Res 2021;35(4):1908-1924 https://doi.org/10.1002/ptr.6935.
19. Sjöström L, Narbro K, Sjöström CD, Karason K, Larsson B, Wedel H, et al. Effects of bariatric surgery on mortality in Swedish obese subjects. N Engl J Med 2007;357(8):741-752 https://doi.org/10.1056/NEJMoa066254.
crossref pmid
20. Gilmartin CE, Vo-Tran TH, Leung L. Complementary medicines in pregnancy: recommendations and information sources of healthcare professionals in Australia. Int J Clin Pharm 2018;40(2):421-427 https://doi.org/10.1007/s11096-018-0608-x.
crossref pmid
21. Perez KJB, Jose MAI, Aranico E, Madamba MRSB. Phytochemical and antibacterial properties of the ethanolic leaf extract of Merremia peltata (L.) Merr. and Rubus spp. Advances in Environmental Biology 2015;9(19):50-56.

22. Alen Y, Sari P, Aldi Y, Nakajima S, Baba N, et al. Extraction, fractionation and cytotoxicity test of Merremia peltata (L.) Merr., (Fam. Convolvulaceae) leaves. Der Pharmacia Lettre 2016;8(11):48-52.

23. Muthi’atul Af-idah B, Hanafi M, Elya B. Antioxidant and alpha-glucosidase inhibitor screening of Merremia peltata L. as potential traditional treatment for diabetes mellitus. Pharmacognosy Journal 2021;13(4):902-908 https://doi.org/10.5530/pj.2021.13.116.
24. Decano DJC, Gagujas MB, Camara JS. Teratogenic activity of corn fungus in bioassay via duck embryos as test media. Journal of Critical Reviews 2020;7(16):200-206 https://doi.org/10.31838/jcr.07.16.27.
25. Hoffman DJ. Embryotoxic and teratogenic effects of petroleum hydrocarbons in mallards (Anas platyrhynchos). J Toxicol Environ Health 1979;5(5):835-844 https://doi.org/10.1080/15287397909529793.
crossref pmid
26. Kondrad SL, Erwin CA. Teratogenic effects of injected methylmercury on avian embryos. Environ Toxicol Chem 2011;30(7):1593-1598 https://doi.org/10.1002/etc.530.
crossref pmid
27. Zhang QW, Lin LG, Ye WC. Techniques for extraction and isolation of natural products: a comprehensive review. Chin Med 2018;13: 20 https://doi.org/10.1186/s13020-018-0177-x.
crossref pmid pmc
28. Tambun R, Alexander V, Ginting Y. Performance comparison of maceration method, soxhletation method, and microwave-assisted extraction in extracting active compounds from soursop leaves (Annona muricata): A review. IOP Conference Series: Materials Science and Engineering 2021;1122: 012095 https://doi.org/10.1088/1757-899X/1122/1/012095.
29. Truong DH, Nguyen DH, Ta NTA, Bui AV, Do TH, Nguyen HC. Evaluation of the use of different solvents for phytochemical constituents, antioxidants, and in vitro anti-inflammatory activities of Severinia buxifolia. Journal of Food Quality 2019;1-9 https://doi.org/10.1155/2019/8178294.
30. Nawaz H, Shad MA, Rehman N, Andaleeb H, Ullah N. Effect of solvent polarity on extraction yield and antioxidant properties of phytochemicals from bean (Phaseolus vulgaris) seeds. Brazilian Journal of Pharmaceutical Sciences 2020;56: e17129. https://doi.org/10.1590/s2175-97902019000417129.
31. Abu F, Mat Taib CN, Mohd Moklas MA, Mohd Akhir S. Antioxidant properties of crude extract, partition extract, and Fermented Medium of Dendrobium sabin Flower. Evid Based Complement Alternat Med 2017;2017: 2907219 https://doi.org/10.1155/2017/2907219.
crossref pmid pmc
32. Abubakar AR, Haque M. Preparation of medicinal plants: Basic extraction and fractionation procedures for experimental purposes. J Pharm Bioallied Sci 2020;12(1):1-10 https://doi.org/10.4103/jpbs.JPBS_175_19.
crossref pmid pmc
33. Gul R, Jan SU, Faridullah S, Sherani S, Jahan N. Preliminary phytochemical screening, quantitative analysis of alkaloids, and antioxidant activity of crude plant extracts from Ephedra intermedia indigenous to Balochistan. Scientific World Journal 2017;2017: 5873648 https://doi.org/10.1155/2017/5873648.
crossref pmid pmc
34. Meyer BN, Ferrigni NR, Putnam JE, Jacobsen LB, Nichols DE, McLaughlin JL. Brine shrimp: a convenient general bioassay for active plant constituents. Planta Med 1982;45(5):31-34 https://doi.org/10.1055/s-2007-971236.
crossref pmid
35. Nerdy N, Lestari P, Sinaga JP, Ginting S, Zebua NF, Mierza V, et al. (Artemia salina Leach.) lethality test of ethanolic extract from green betel (Piper betle Linn.) and red betel (Piper crocatum Ruiz and Pav.) through thesoxhletation method for cytotoxicity test. Open Access Macedonian Journal of Medical Sciences 2021;9(A):407-412 https://doi.org/10.3889/oamjms.2021.
36. Khosravi A, Sharifi I, Tavakkoli H, Derakhshanfar A, Keyhani AR, Salari Z, et al. Embryonic toxico-pathological effects of meglumine antimoniate using a chick embryo model. PLoS One 2018;13(5):e0196424. https://doi.org/10.1371/journal.pone.0196424.
crossref pmid pmc
37. Parasuraman S. Toxicological screening. J Pharmacol Pharmacother 2011;2(2):74-79 https://doi.org/10.4103/0976-500X.81895.
crossref pmid pmc
38. Kundeková B, Máčajová M, Meta M, Bilčík B. Chorioallantoic membrane models of various avian species: differences and applications. Biology (Basel) 2021;10(4):301 http://doi.org/10.3390/biology10040301.
crossref pmid pmc
39. Luay MAM, Gonzaga MFR, Po SKD, Arollado EC. Determination of the antiangiogenic activity of Telescopium telescopium (horn snail) extract using in ovo chorioallantoic membrane (CAM) assay. Acta Medica Philippina 2018;52(4):https://doi.org/10.47895/amp.v52i4.379.
40. Jacobsen ID, Grosse K, Hube B. Embryonated chicken eggs as alternative infection model for pathogenic fungi. Methods Mol Biol 2012;845: 487-496 https://doi.org/10.1007/978-1-61779-539-8_34.
crossref pmid
41. Omori A, Harada M, Ohta S, Villacorte M, Sugimura Y, Shiraishi T, et al. Epithelial Bmp (Bone morphogenetic protein) signaling for bulbourethral gland development: a mouse model for congenital cystic dilation. Congenit Anom (Kyoto) 2011;51(3):102-109 https://doi.org/10.1111/j.1741-4520.2011.00318.x.
crossref pmid
42. Salari Z, Tavakkoli H, Khosravi A, Karamad E, Salarkia E, Ansari M, et al. Embryo-toxicity of docosahexaenoic and eicosapentaenoic acids: In vivo and in silico investigations using the chick embryo model. Biomed Pharmacother 2021;136: 111218 https://doi.org/10.1016/j.biopha.2021.111218.
crossref pmid
43. Heymans C, Delcorte O, Spourquet C, Villacorte-Tabelin M, Dupasquier S, Achouri Y, et al. Spatio-temporal expression pattern and role of the tight junction protein MarvelD3 in pancreas development and function. Scientific Reports 2021;11: 14519 https://doi.org/10.1038/s41598-021-93654-2.
crossref pmid pmc
44. Clarkson C, Maharaj VJ, Crouch NR, Grace OM, Pillay P, Matsabisa MG, et al. In vitro antiplasmodial activity of medicinal plants native to or naturalised in South Africa. J Ethnopharmacol 2004;92(2-3):177-191 https://doi.org/10.1016/j.jep.2004.02.011.
crossref pmid
45. Li S, Bai S, Qin X, Zhang J, Irwin DM, Zhang S, et al. Comparison of whole embryonic development in the duck (Anas platyrhynchos) and goose (Anser cygnoides) with the chicken (Gallus gallus). Poultry Science 2019;98(8):3278-3291 https://doi.org/10.3382/ps/pez133.
crossref pmid
46. Kifayatullah M, Mustafa MS, Sengupta P, Sarker MMR, Das A, Das SK. Evaluation of the acute and sub-acute toxicity of the ethanolic extract of Pericampylus glaucus (Lam.) Merr. in BALB/c mice. Journal of Acute Disease 2015;4(4):309-315 https://doi.org/10.1016/j.joad.2015.06.010.
47. Vaghasiya YK, Shukla VJ, Chanda SV. Acute oral toxicity study of Pluchea arguta boiss extract in mice. Journal of Pharmacology and Toxicology 2011;6(2):113-123 https://doi.org/10.3923/jpt.2011.113.123.
48. Panche AN, Diwan AD, Chandra SR. Flavonoids: an overview. J Nutr Sci 2016;5: e47 https://doi.org/10.1017/jns.2016.41.
crossref pmid pmc
49. Corcoran MP, McKay DL, Blumberg JB. Flavonoid basics: chemistry, sources, mechanisms of action, and safety. J Nutr Gerontol Geriatr 2012;31(3):176-189 https://doi.org/10.1080/21551197.2012.698219.
crossref pmid
50. Woldemichael GM, Wink M. Identification and biological activities of triterpenoid saponins from Chenopodium quinoa. J Agric Food Chem 2001;49(5):2327-2332 https://doi.org/10.1021/jf0013499.
crossref pmid
51. Tagousop CN, Tamokou J, Ngnokam D, Voutquenne-Nazabadioko L. Antimicrobial activities of saponins from Melanthera elliptica and their synergistic effects with antibiotics against pathogenic phenotypes. Chem Cent J 2018;12(1):97 https://doi.org/10.1186/s13065-018-0466-6.
crossref pmid pmc
52. Sung WS, Lee DG. The combination effect of Korean red ginseng saponins with kanamycin and cefotaxime against methicillin-resistant Staphylococcus aureus. Biol Pharm Bull 2008;31(8):1614-1617 https://doi.org/10.1248/bpb.31.1614.
crossref pmid
53. Cirioni O, Myszka H, Dawgul M, Ghiselli R, Orlando F, Silvestri C, et al. In vitro activity and in vivo efficacy of the saponin diosgenyl 2-amino-2-deoxy-β-D-glucopyranoside hydrochloride (HSM1) alone and in combination with daptomycin and vancomycin against Gram-positive cocci. J Med Microbiol 2011;60(Pt 9):1337-1343 https://doi.org/10.1099/jmm.0.031708-0.
crossref pmid
54. Tong Z, He W, Fan X, Guo A. Biological function of plant tannin and its application in animal health. Front Vet Sci 2021;8: 803657 https://doi.org/10.3389/fvets.2021.803657.
crossref pmid pmc
55. Ibrahim MB, Sowemimo AA, Sofidiya MO, Badmos KB, Fageyinbo MS, Abdulkareem FB, et al. Sub-acute and chronic toxicity profiles of Markhamia tomentosa ethanolic leaf extract in rats. J Ethnopharmacol 2016;193: 68-75 https://doi.org/10.1016/j.jep.2016.07.036.
crossref pmid
56. Ugwah-Oguejiofor CJ, Okoli CO, Ugwah MO, Umaru ML, Ogbulie CS, Mshelia HE, et al. Acute and sub-acute toxicity of aqueous extract of aerial parts of Caralluma dalzielii N. E. Brown in mice and rats. Heliyon 2019;5(1):e01179. https://doi.org/10.1016/j.heliyon.2019.e01179.
crossref pmid pmc
57. Ritieni A, Monti SM, Randazzo G, Logrieco A, Moretti A, Peluso G, et al. Teratogenic effects of fusaproliferin on chicken embryos. Journal of Agricultural and Food Chemistry 1997;45(8):3039-3043 https://doi.org/10.1021/jf960890v.
58. Hlywka JJ, Beck MM, Bullerman LB. The use of the chicken embryo screening test and brine shrimp (Artemia salina) bioassays to assess the toxicity of fumonisin B1 mycotoxin. Food Chem Toxicol 1997;35(10-11):991-999 https://doi.org/10.1016/s0278-6915(97)87268-7.
crossref pmid
59. Nwodo UU, Ngene AA, Anaga AO, Chigor VN, Henrietta II, Okoh AI. Acute toxicity and hepatotoxicokinetic studies of Tamarindus indica extract. Molecules 2011;16(9):7415-7427 https://doi.org/10.3390/molecules16097415.
crossref pmid pmc
60. Waghulde S, Kale MK, Patil V. Brine shrimp lethality assay of the aqueous and ethanolic extracts of the selected species of medicinal plants. Proceedings 2019;41(1):47 https://doi.org/10.3390/ecsoc-23-06703.
61. Olatunji TL, Adetunji AE, Olisah C, Idris OA, Saliu OD, Siebert F. Research progression of the genus Merremia: A comprehensive review on the nutritional value, ethnomedicinal uses, phytochemistry, pharmacology, and toxicity. Plants (Basel) 2021;10(10):2070 https://doi.org/10.3390/plants10102070.
crossref pmid pmc
62. Eun JP, Koh GY. Suppression of angiogenesis by the plant alkaloid, sanguinarine. Biochem Biophys Res Commun 2004;317(2):618-624 https://doi.org/10.1016/j.bbrc.2004.03.077.
crossref pmid
63. Brito LB, Filho GBS, Chaves HAS, Nascimento ALO, Braga TC, Pfister J, et al. Spontaneous and experimental poisoning by Merremia macrocalyx (Convolvulaceae) in cattle. Pesquisa Veterinária Brasileira 2019;39(7):447-453 https://doi.org/10.1590/1678-5150-PVB-6335.
64. Adebiyi OA, Ameh DA, Onyike E, James DB. Acute and chronic toxicity studies of ethanol leaf extract of Merremia tridentata (LiNn) Hallier F. European Journal of Advanced Chemistry Research 2021;2(3):14-20 https://doi.org/10.24018/ejchem.2021.2.3.62.
65. Zhao Y, Xia Q, Yin JJ, Lin G, Fu PP. Photoirradiation of dehydropyrrolizidine alkaloids--formation of reactive oxygen species and induction of lipid peroxidation. Toxicol Lett 2011;205(3):302-309 https://doi.org/10.1016/j.toxlet.2011.06.020.
crossref pmid

Figure 1.
Percent mortality values of Decalobanthus peltatus plant extracts in five different concentrations with three replicates each.
Figure 2.
Sample images for the ImageJ software analysis of vascular density negative control (A, D, G and J), 1000 ppm (B, E, H and K) and 500ppm (C, F, I and L); (A-C) raw image, (D-F) green channel extraction (G-J) binarized images, (I-L) skeletonized image. (Data acquired on the 7th day of incubation period). Scale bar: 5 mm.
Figure 3.
Effect of D. peltatus on early embryonic vasculogenesis and angiogenesis using the number of junctions, average branch length, vascular density, and vascular length density quantification. Data are presented with comparison between the control (n = 10) and D. peltatus at concentrations of 1000 ppm (n = 10) or 500 ppm (n = 10). The number of junctions was reduced in D. peltatus-treated group at 1000 ppm (A). The average branch lengths of the treated groups were higher than that of the control group, indicating lesser tertiary vessels on the treated groups (B). Vascular density and vascular length density were lower in the treated groups than the control group (C and D). Error bars exhibit standard error of mean; p<0.05, two-way ANOVA.
Figure 4.
Effect of ethyl acetate leaf extracts of Decalobanthus peltatus on diameter measurements of primary, secondary, and tertiary vessels. Data are presented with the comparison between the control (n = 10) and D. peltatus at concentrations of 1000 ppm (n = 10) or 500 ppm (n = 10). The Error bars exhibit standard error of mean; p<0.05, two-way ANOVA.
Figure 5.
Gross morphology of the duck embryo treated with D. peltatus ethyl acetate leaf extracts. Lesions during the first (A-C), second (D-F), and third (G-I) trimesters of the growing period are presented with comparison between the control (A, D and G) and D. peltatus-treated embryos at concentrations of 1000 ppm (B, E and H) or 500 ppm (C, F, and I) —the weight (J) of the duck embryos following treatment of D. peltatus ethyl acetate leaf extract. The weight at days 7, 14, and 21 of the incubation periods is presented with comparison between control (n = 10) and D. peltatus-treated embryos at concentrations of 1000 ppm (n = 10) or 500 ppm (n = 10). The embryos that received 1000 ppm of D. peltatus extract were higher than the controls at the above maintained time points. Scale bars: 1 mm for A-C; 5 mm for D-F; 10 mm for G-I.
Figure 6.
Histopathological analysis by D. peltatus leaf extract in the duck embryo skin tissue. Tissues were observed on day 14 (A-C) and day 21 of the incubation period (12 and 19 days after treatment) (D-F) with comparison between the control (A and D) and M. peltatus-treated embryos at concentrations of 1000 ppm (B and E) or 500 ppm (C and F). Normal structures of the skin with intact dermis and epidermis layer. Phenotypes of D. peltatus-treated embryos included abnormal dermis and hypodermis morphology (E, F) and a reduced number of feather follicles (E). Scale bar: 50 μm.
Table 1.
Phytochemical screening of the methanolic crude extracts of D. peltatus indicating its phytochemical constituents with its level of detection, high detection (+++), moderate detection (++), low detection (+).
Sample code Alkaloids Flavonoids Saponins Steroids Tannins
D. peltatus (+) (+++) (+++) (+) (+++)


(+++) – presence is rich or very rich.

(++) – presence is in moderate amount.

(+) – presence is very poor

Table 2.
LC50 values of the different plant extracts showing different toxicity classification as shown in (+) sign beside their value. (+++) being the highly toxic (++) for medium toxic, (+) for low toxic, and (-) for the non-toxic.
Extract LC50 Toxicity
Aqueous 141.25 ppm (++)
Ethyl acetate 14.54 ppm (+++)
Hexane 26.30 ppm (+++)
Methanol 112.20 ppm (++)
PDF Links  PDF Links
PubReader  PubReader
ePub Link  ePub Link
XML Download  XML Download
Full text via DOI  Full text via DOI
Download Citation  Download Citation
Editorial Office
Division of Environmental Science and Ecological Engineering, Korea University
145 Anam-ro, Seongbuk-gu, Seoul 02841, Korea
Tel : +82-32-560-7520   E-mail: envitoxic@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © 2024 by The Korean Society of Environmental Health and Toxicology & Korea Society for Environmental Analysis.     Developed in M2PI